A collection of high-quality human assemblies

<p>A collection of high-quality human assemblies, including:</p> <ul> <li><a href="https://github.com/marbl/CHM13">T2T-CHM13</a> v2.0 analysis set with HG002 chrY and rCRS chrM</li> <li>GRCh38 <a href="https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/">no-alt analysis set</a> with rCRS chrM</li> <li><a href="https://www.nature.com/articles/s41422-023-00849-5">CN1</a> v1.0.1</li> <li><a href="https://www.sciencedirect.com/science/article/pii/S1672022923001006">YAO</a> v1.1</li> <li><a href="https://www.nature.com/articles/s41597-024-04121-2">KSA001</a> v1.1.0</li> <li>232 HPRC r2/v0.6 samples (464 assemblies; HG00272 has a ~50Mb inversion misassembly)</li> </ul> <p>Use <a href="https://github.com/refresh-bio/agc/releases">AGC</a> to extract indivual genomes and use <a href="https://github.com/lh3/ropebwt3">ropebwt3</a> to query the FM-index:</p> <blockquote> <p>agc listset human472.agc &nbsp; # list genomes<br>agc getset human472.agc 200149_HG02523.pat &gt; HG02523.pat.fa # extract one genome<br>gzip -d human472.fmr.gz &nbsp; &nbsp; # decompress the incremental index<br>ropebwt3 build -i human472.fmr -do human472.fmd &nbsp;# convert to a faster query format<br>gzip -d human472.fmd.ssa.gz &nbsp;# decompress suffix array samples<br>echo CCAGGACCCCTGTCCAGTGTTAGACAGGAGCATGCAG | ropebwt3 sw -eN200 -Lm10 human472.fmd -</p> </blockquote> <p><strong>Note:</strong> The HPRC assemblies are already available from GenBank. This repository only provides a convenient way to download them. However, these assemblies are not formally published. You may use them for algorithm development or performance evaluation. If you want to use the genomes for biological discovery, please&nbsp;<a href="https://humanpangenome.org/contact/">contact HPRC</a>.</p>