Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.