zenodoopen
FIGURE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories
FIGURE 6. Primers used for amplifying and sequencing the control region and adjacent tRNAs. Internal primers 5'-3': 662F – ACCATGCCAAGGCGTTCTTT, 662R – AAAGAACGCCTTGGCATGGT, 724F – ACATTTGGTCACTTTCG- GAGA, 462R – CGGTTGGTGGTCTCTTACTACA, F-TTF2 – CGCCACCAGAAAAGAGAGAT, and F-12R2 - GCCCGTGGAACTTTCTAGG
ShareScore
32/100
Overall dataset sharing score
Score breakdown
These five areas show where the dataset supports — or may limit — practical reuse.
- Stewardship
- 8
- Harmonization
- 4
- Access
- 12
- Reuse readiness
- 8
- Engagement
- 0
Topics
ScienceDex for faculty
Your academic CV and NIH biosketch
Make your CV in your school's format and your NIH biosketch from it, then download both as Word files.