Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.