rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022&nbsp;and supplemented with the FishCARD sequences from&nbsp;https://doi.org/10.5281/zenodo.4315277 .</p> <p>Primer Name:&nbsp; MiFish Universal<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 163&ndash;185<br> get_seeds_local() minimum length:&nbsp; &nbsp; 170<br> get_seeds_local() maximum length:&nbsp; &nbsp; 250<br> blast_seeds() minimum length:&nbsp; &nbsp; 140<br> blast_seeds() maximum length:&nbsp; &nbsp; 250<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p> <p>&nbsp;</p>