Skip to main content
ConductScienceScienceDex
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

18

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

18 results for “rCRUX”

Learn how ShareScore rates datasets ↗
zenodo40/100

rCRUX Generated MiFish Universal 12S Reference Database

<p>rCRUX generated reference database using NCBI nt blast database downloaded in January 2024.</p> <p>Primer Name:&nbsp; MiFish Universal<br>Gene:&nbsp; &nbsp;12S<br>Length of Target:&nbsp; &nbsp; 163&ndash;185<br>get_seeds_local() minimum length:&nbsp; &nbsp; 170<br>get_seeds_local() maximum length:&nbsp; &nbsp; 400<br>blast_seeds() minimum length:&nbsp; &nbsp; 140<br>blast_seeds() maximum length:&nbsp; &nbsp; 400<br>max_to_blast:&nbsp;&nbsp;1000<br>Forward Sequence (5'-3'):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br>Reverse Sequence (5'-3'):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br>Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. &nbsp;</p> <p>&nbsp;</p> <p>This project was funded by the NOAA 'Omics Program.</p>

opencc-by-4.0May 2024View details →
zenodo40/100

rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022&nbsp;and supplemented with the FishCARD sequences from&nbsp;https://doi.org/10.5281/zenodo.4315277 .</p> <p>Primer Name:&nbsp; MiFish Universal<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 163&ndash;185<br> get_seeds_local() minimum length:&nbsp; &nbsp; 170<br> get_seeds_local() maximum length:&nbsp; &nbsp; 250<br> blast_seeds() minimum length:&nbsp; &nbsp; 140<br> blast_seeds() maximum length:&nbsp; &nbsp; 250<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p> <p>&nbsp;</p>

opencc-by-4.0Oct 2023View details →
zenodo40/100

rCRUX Generated Cephalpod 18S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Ceph18S<br> Gene:&nbsp; &nbsp;18S<br> Length of Target:&nbsp; &nbsp; 150&ndash;190<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 235<br> blast_seeds() minimum length:&nbsp; &nbsp; 65<br> blast_seeds() maximum length:&nbsp; &nbsp; 195<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;CGCGGCGCTACATATTAGAC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GCACTTAACCGACCGTCGAC<br> Reference:&nbsp; &nbsp; D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021)&nbsp;<a href="https://doi.org/10.1098/rsos.201388">https://doi.org/10.1098/rsos.201388</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated MiFish Universal 12S Expanded Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.</p> <p>Primer Name:&nbsp; MiFish Universal<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 163&ndash;185<br> get_seeds_local() minimum length:&nbsp; &nbsp; 170<br> get_seeds_local() maximum length:&nbsp; &nbsp; 250<br> blast_seeds() minimum length:&nbsp; &nbsp; 140<br> blast_seeds() maximum length:&nbsp; &nbsp; 250<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Fungal ITS Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Fungal_ITS gITS7/ITS4<br> Gene:&nbsp; &nbsp;FITS<br> Length of Target:&nbsp; &nbsp; 150-330<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 500<br> blast_seeds() minimum length:&nbsp; &nbsp; 65<br> blast_seeds() maximum length:&nbsp; &nbsp; 461<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGARTCATCGARTCTTTG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; TCCTCCGCTTATTGATATGC<br> Reference:&nbsp; &nbsp; White, T. J., Bruns, T., Lee, S., &amp; Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315&ndash;322.<br> Ihrmark, K., B&ouml;deker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandstr&ouml;m-Durling, M., &amp; Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region&ndash;evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666&ndash;677.&nbsp;https://doi.org/10.1111/j.1574-6941.2012.01437.x</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Ford Fish 16S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Ford Fish 16S<br> Gene:&nbsp; &nbsp;16S<br> Length of Target:&nbsp; &nbsp; 330<br> get_seeds_local() minimum length:&nbsp; &nbsp; 279<br> get_seeds_local() maximum length:&nbsp; &nbsp; 477<br> blast_seeds() minimum length:&nbsp; &nbsp; 231<br> blast_seeds() maximum length:&nbsp; &nbsp; 429<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GGATTGCGCTGTTATCCCTA<br> Reference:&nbsp; &nbsp; Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population&rsquo;s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated ITS2 Plants Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; ITS2 Plants<br> Gene:&nbsp; &nbsp;ITS2<br> Length of Target:&nbsp; &nbsp; 450-550<br> get_seeds_local() minimum length:&nbsp; &nbsp; 315<br> get_seeds_local() maximum length:&nbsp; &nbsp; 600<br> blast_seeds() minimum length:&nbsp; &nbsp; 270<br> blast_seeds() maximum length:&nbsp; &nbsp; 560<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;ATGCGATACTTGGTGTGAAT<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GACGCTTCTCCAGACTACAAT<br> Reference:&nbsp; &nbsp; Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... &amp; Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818.&nbsp;<a href="https://doi.org/10.1371/journal.pone.0067818">https://doi.org/10.1371/journal.pone.0067818</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Kelly Metazoan 16S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Kelly Metazoan 16S<br> Gene:&nbsp; &nbsp;16S<br> Length of Target:&nbsp; &nbsp; 114-160<br> get_seeds_local() minimum length:&nbsp; &nbsp; 80<br> get_seeds_local() maximum length:&nbsp; &nbsp; 195<br> blast_seeds() minimum length:&nbsp; &nbsp; 50<br> blast_seeds() maximum length:&nbsp; &nbsp; 168<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;AGTTACYYTAGGGATAACAGCG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CCGGTCTGAACTCAGATCAYGT<br> Reference:&nbsp; &nbsp; Kelly, R. P., O&rsquo;Donnell, J. L., Lowell, N. C., Shelton, A. O., Samhouri, J. F., Hennessey, S. M., ... &amp; Williams, G. D. (2016). Genetic signatures of ecological diversity along an urbanization gradient. PeerJ, 4, e2444.&nbsp;https://doi.org/10.7717/peerj.2444</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated MiDeca Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; MiDeca<br> Gene:&nbsp; &nbsp;16S<br> Length of Target:&nbsp; &nbsp; 154-184<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 230<br> blast_seeds() minimum length:&nbsp; &nbsp; 66<br> blast_seeds() maximum length:&nbsp; &nbsp; 191<br> max_to_blast:&nbsp; 50<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GGACGATAAGACCCTATAAA<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; ACGCTGTTATCCCTAAAGT<br> Reference:&nbsp; &nbsp;Komai, T., Gotoh, R.O., Sado, T. and Miya, M., 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. Metabarcoding and Metagenomics, 3, p.e33835.&nbsp;https://doi.org/10.3897/mbmg.6.76534</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated MarVer3 Marine Mammal Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; MarVer3 Marine Mammal<br> Gene:&nbsp; &nbsp;16S<br> Length of Target:&nbsp; &nbsp; 232-274<br> get_seeds_local() minimum length:&nbsp; &nbsp; 160<br> get_seeds_local() maximum length:&nbsp; &nbsp; 345<br> blast_seeds() minimum length:&nbsp; &nbsp; 124<br> blast_seeds() maximum length:&nbsp; &nbsp; 309<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;AGACGAGAAGACCCTRTG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GGATTGCGCTGTTATCCC<br> Reference:&nbsp; &nbsp; Valsecchi, E., Bylemans, J., Goodman, S. J., Lombardi, R., Carr, I., Castellano, L., ... &amp; Galli, P. (2020). Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. Environmental DNA, 2(4), 460-476.&nbsp;https://doi.org/10.1002/edn3.72</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated 18s SSU3/SSU4 Metazoan Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; 18s SSU3/SSU4 Metazoan<br> Gene:&nbsp; &nbsp;18S v7<br> Length of Target:&nbsp; &nbsp; 170<br> get_seeds_local() minimum length:&nbsp; &nbsp; 120<br> get_seeds_local() maximum length:&nbsp; &nbsp; 220<br> blast_seeds() minimum length:&nbsp; &nbsp; 98<br> blast_seeds() maximum length:&nbsp; &nbsp; 200<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GGTCTGTGATGCCCTTAGATG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GGTGTGTACAAAGGGCAGGG<br> Reference:&nbsp; &nbsp;McInnes, J. C., Alderman, R., Deagle, B. E., Lea, M. A., Raymond, B., &amp; Jarman, S. N. (2017). Optimised scat collection protocols for dietary DNA metabarcoding in vertebrates. Methods in Ecology and Evolution, 8(2), 192-202.&nbsp;http://dx.doi.org/10.1111/2041-210X.12677</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated MiFish Universal 12S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; MiFish Universal<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 163&ndash;185<br> get_seeds_local() minimum length:&nbsp; &nbsp; 170<br> get_seeds_local() maximum length:&nbsp; &nbsp; 250<br> blast_seeds() minimum length:&nbsp; &nbsp; 140<br> blast_seeds() maximum length:&nbsp; &nbsp; 250<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Baker Dlp1.5-H/Oordlp4 Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Scott Baker Dlp1.5-H/Oordlp4<br> Gene:&nbsp; &nbsp;D loop<br> Length of Target:&nbsp; &nbsp; 350-390<br> get_seeds_local() minimum length:&nbsp; &nbsp; 245<br> get_seeds_local() maximum length:&nbsp; &nbsp; 495<br> blast_seeds() minimum length:&nbsp; &nbsp; 205<br> blast_seeds() maximum length:&nbsp; &nbsp; 455<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;TCACCCAAAGCTGRARTTCTA<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GCGGGTTGCTGGTTTCACG<br> Reference:&nbsp; &nbsp;Baker, C. S., Steel, D., Nieukirk, S., &amp; Klinck, H. (2018). Environmental DNA (eDNA) from the wake of the whales: Droplet digital PCR for detection and species identification. Frontiers in Marine Science, 5, 133.&nbsp;https://doi.org/10.3389/fmars.2018.00133</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated MiSebastes Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; MiSebastes<br> Gene:&nbsp; &nbsp;CytB<br> Length of Target:&nbsp; &nbsp; 153<br> get_seeds_local() minimum length:&nbsp; &nbsp; 107<br> get_seeds_local() maximum length:&nbsp; &nbsp; 199<br> blast_seeds() minimum length:&nbsp; &nbsp; 71<br> blast_seeds() maximum length:&nbsp; &nbsp; 163<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;AAGCTCATTCAAGTGCTT<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GACCACTTACACAATTCT<br> Reference:&nbsp; &nbsp;Min, M. A., Barber, P. H., &amp; Gold, Z. (2021). MiSebastes: An eDNA metabarcoding primer set for rockfishes (genus Sebastes). Conservation Genetics Resources, 13(4), 447-456.&nbsp;https://doi.org/10.1007/s12686-021-01219-2</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Taberlet c/h trnl Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Taberlet c/h trnl<br> Gene:&nbsp; &nbsp;trnl<br> Length of Target:&nbsp; &nbsp; 150<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 150<br> blast_seeds() minimum length:&nbsp; &nbsp; 85<br> blast_seeds() maximum length:&nbsp; &nbsp; 128<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;CGAAATCGGTAGACGCTACG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CCATTGAGTCTCTGCACCTATC<br> Reference:&nbsp; &nbsp;Taberlet, P., Gielly, L., Pautou, G., &amp; Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of. Plant molecular biology, 17, 1105-1109. &amp; Taberlet, Pierre, Eric Coissac, Fran&ccedil;ois Pompanon, Ludovic Gielly, Christian Miquel, Alice Valentini, Thierry Vermat, Gerard Corthier, Christian Brochmann, and Eske Willerslev. &quot;Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding.&quot; Nucleic acids research 35, no. 3 (2007): e14-e14.</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Teleo Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; teleo L1848/H1913<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 100<br> get_seeds_local() minimum length:&nbsp; &nbsp; 70<br> get_seeds_local() maximum length:&nbsp; &nbsp; 130<br> blast_seeds() minimum length:&nbsp; &nbsp; 40<br> blast_seeds() maximum length:&nbsp; &nbsp; 100<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;ACACCGCCCGTCACTCT<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CTTCCGGTACACTTACCATG<br> Reference:&nbsp; &nbsp;Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., ... &amp; Gaboriaud, C. (2016). Next‐generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology, 25(4), 929-942.&nbsp;https://doi.org/10.1111/mec.13428</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated trnl plants Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; trnl plants<br> Gene:&nbsp; &nbsp;trnl<br> Length of Target:&nbsp; &nbsp; ~85<br> get_seeds_local() minimum length:&nbsp; &nbsp; 60<br> get_seeds_local() maximum length:&nbsp; &nbsp; 110<br> blast_seeds() minimum length:&nbsp; &nbsp; 23<br> blast_seeds() maximum length:&nbsp; &nbsp; 73<br> max_to_blast:&nbsp; 250<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GGGCAATCCTGAGCCAA<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; TTTGAGTCTCTGCACCTATC<br> Reference:&nbsp; &nbsp;Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... &amp; Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007).&nbsp;https://doi.org/10.1093%2Fnar%2Fgkl938</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo32/100

rCRUX Generated rbcl (Plant RBCL7/8) Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; rbcl (Plant RBCL7/8)<br> Gene:&nbsp; &nbsp;rbcl<br> Length of Target:&nbsp; &nbsp; 180<br> get_seeds_local() minimum length:&nbsp; &nbsp; 170<br> get_seeds_local() maximum length:&nbsp; &nbsp; 250<br> blast_seeds() minimum length:&nbsp; &nbsp; 140<br> blast_seeds() maximum length:&nbsp; &nbsp; 150<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;CTCCTGAMTAYGAAACCAAAGA<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GTAGCAGCGCCCTTTGTAAC<br> Reference:&nbsp; &nbsp;McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302&ndash;2311. https://doi.org/10.1111/mec.13608 &amp; Spence, A. R., Wilson Rankin, E. E., &amp; Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074.&nbsp;http://dx.doi.org/10.1093/auk/uky003</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record