rCRUX Generated Teleo Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; teleo L1848/H1913<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 100<br> get_seeds_local() minimum length:&nbsp; &nbsp; 70<br> get_seeds_local() maximum length:&nbsp; &nbsp; 130<br> blast_seeds() minimum length:&nbsp; &nbsp; 40<br> blast_seeds() maximum length:&nbsp; &nbsp; 100<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;ACACCGCCCGTCACTCT<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CTTCCGGTACACTTACCATG<br> Reference:&nbsp; &nbsp;Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., ... &amp; Gaboriaud, C. (2016). Next‐generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology, 25(4), 929-942.&nbsp;https://doi.org/10.1111/mec.13428</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>