rCRUX Generated trnl plants Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; trnl plants<br> Gene:&nbsp; &nbsp;trnl<br> Length of Target:&nbsp; &nbsp; ~85<br> get_seeds_local() minimum length:&nbsp; &nbsp; 60<br> get_seeds_local() maximum length:&nbsp; &nbsp; 110<br> blast_seeds() minimum length:&nbsp; &nbsp; 23<br> blast_seeds() maximum length:&nbsp; &nbsp; 73<br> max_to_blast:&nbsp; 250<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GGGCAATCCTGAGCCAA<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; TTTGAGTCTCTGCACCTATC<br> Reference:&nbsp; &nbsp;Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... &amp; Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007).&nbsp;https://doi.org/10.1093%2Fnar%2Fgkl938</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>