rCRUX Generated 18s SSU3/SSU4 Metazoan Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; 18s SSU3/SSU4 Metazoan<br> Gene:&nbsp; &nbsp;18S v7<br> Length of Target:&nbsp; &nbsp; 170<br> get_seeds_local() minimum length:&nbsp; &nbsp; 120<br> get_seeds_local() maximum length:&nbsp; &nbsp; 220<br> blast_seeds() minimum length:&nbsp; &nbsp; 98<br> blast_seeds() maximum length:&nbsp; &nbsp; 200<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GGTCTGTGATGCCCTTAGATG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GGTGTGTACAAAGGGCAGGG<br> Reference:&nbsp; &nbsp;McInnes, J. C., Alderman, R., Deagle, B. E., Lea, M. A., Raymond, B., &amp; Jarman, S. N. (2017). Optimised scat collection protocols for dietary DNA metabarcoding in vertebrates. Methods in Ecology and Evolution, 8(2), 192-202.&nbsp;http://dx.doi.org/10.1111/2041-210X.12677</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>