rCRUX Generated rbcl (Plant RBCL7/8) Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: rbcl (Plant RBCL7/8)<br> Gene: rbcl<br> Length of Target: 180<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 150<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA<br> Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC<br> Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
ShareScore
32/100
Overall dataset sharing score
Score breakdown
These five areas show where the dataset supports — or may limit — practical reuse.
- Stewardship
- 8
- Harmonization
- 4
- Access
- 16
- Reuse readiness
- 0
- Engagement
- 4