Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
24
datasets available to search
ShareScore release 0.9.0
Dataset results
24 results for “rbcl”
Qiime2 classifiers (rbcl, Mollusc 18s) for testing the validity of using eDNA for carbon origin analysis from sediment cores
<p>Qiime2 formatted classifiers that were created for a Natural England funded project by researchers at the James Hutton Institute. The pilot project aims to test the validity of using eDNA for carbon origin analysis from sediment cores. These classifiers for the rbcl and 18 Mollusc genes were made using RESCRIPt and Qiime2. </p> <p>The scripts used to created these classifiers are available at the James Hutton ICS GitHub <a href="https://github.com/HuttonICS/blue-carbon-db">blue-carbon-db</a> . The files are as follows:</p> <p><a href="../api/records/10046481/draft/files/mollusc-espineira-classifier.qza/content" target="_blank" rel="noopener noreferrer">mollusc-espineira-classifier.qza</a> is a classifer built from ncbi 18s Mollusc sequences, trained on the primer set from Espiñeira et al (2009).</p> <div>rbcl-vasselon-zimmerman-F3-R1-classifier.qza is a classifer built from ncbi rbcl sequences, trained on the F3 and R1 primer set fromVasselon et al (2017).</div> <p> </p> <p> </p> <p><strong>Important: </strong>If you use these classifiers please be aware of the process used to create them and be sure to review the methods. These databases were created by downloading data from the NCBI in October 2023, sequence data available at the NCBI changes over time. To create the most up to date database a fresh download and re-evaluations of the databases would be preferable. All method and scripts can be found at <a href="https://github.com/HuttonICS/blue-carbon-db">blue-carbon-db </a></p> <p>If you use these database please reference this repository along with RESCRIPt and Qiime2 </p> <p> </p> <p>Espiñeira, M., González-Lavín, N., Vieites, J. M. and Santaclara, F. J. 2009 Development of a method for the genetic identification of commercial bivalve species based on mitochondrial 18S rRNA sequences. J Agric Food Chem, 28, 495-502 https://doi.org/10.1021/jf802787d</p> <p> </p> <p>Vasselon, V., Rimet, F., Tapolczai, K. and Bouchez, A. 2017. Assessing ecological status with diatoms DNA metabarcoding: Scaling-up on a WFD monitoring network (Mayotte island, France). Ecological Indicators, 82, 1-12 <a title="Persistent link using digital object identifier" href="https://doi.org/10.1016/j.ecolind.2017.06.024" target="_blank" rel="noreferrer noopener">https://doi.org/10.1016/j.ecolind.2017.06.024</a></p>
rbcL reference sequences of marine and freshwater diatoms
<p>This database has been modified from the R-syst::Diatom rbcL database, version 9, accessed on 3.18.2021. (see Rimet et al.2016 for details)</p> <p>Sequences of mostly <em>Pseudo-nitzschia</em> from the Gulf of Trieste and some others missing from the database were added.</p> <p>The names of the sequences in the .fasta file are formatted in a way that they can be used directly in dada2 for taxonomic classification. </p> <p>This database represents a comprehensive marine diatom sequence archive. </p>
Genus level DNA sequence data for three genes (matK, rbcL, trnH-psbA) for the paper: A comprehensive, genus-level time-calibrated phylogeny of the tree flora of Mediterranean Europe and an assessment of its vulnerability
<p>This data file contains the consensus DNA sequences in fasta format, of 64 tree genera found in Mediterranean Europe, following the checklist of Médail et al. (2019). </p> <p>The data are used in a manuscript submitted for publication to Botany Letters and currently under revision. The manuscript is entitled: "<em>A comprehensive, genus-level time-calibrated phylogeny of the tree flora of Mediterranean Europe and an assessment of its vulnerability</em>". Its authors are: Marwan Cheikh Albassatneh, Marcial Escudero, Loic Ponge<sup>*</sup>, Anne-Christine Monnet, Juan Arroyo, Toni Nikolic, Gianluigi Bacchetta, Francesca Bagnoli, Panayotis Dimopoulos, Agathe Leriche, Frédéric Médail, Anne Roig, Ilaria Spanu, Giovanni Giuseppe Vendramin, Arndt Hampe, Bruno Fady.</p>
Data from: Delineating seagrass species in the genera Halodule and Halophila from Tanzanian coastal waters using ITS and rbcL DNA barcoding
<p>The seagrass species in <em>Halodule</em> and <em>Halophila</em> may for several reasons be considered as taxonomic complexes. They show close evolutionary relationships, morphological plasticity, and share similar features making misidentifications likely when morphological identification is applied. In Tanzanian coastal waters, there is some uncertainty about the identity of members of <em>Halodule</em>, particularly the existence of <em>Halodule wrightii</em> and the species composition of the <em>Halophila ovalis</em> complex. This study used morphology as well as internal transcribed spacer (ITS1 and ITS2) and ribulose-bisphosphate carboxylase (rbcL) DNA barcoding to identify species of <em>Halodule</em> and <em>Halophila</em>. Seagrass samples were collected during low spring tides, from Tanzania's coastal waters of Tanga, Dar es Salaam, Mtwara, Mafia Island, and Unguja Island, from August 2020 to February 2022. Morphological diagnosis, phylogenetic analysis, and evolutionary divergences inferred from the ITS gene supported the identification of five species, namely <em>Halophila ovalis</em>, <em>H. minor,</em> and <em>H. stipulacea</em>, with the first two forming the <em>H. ovalis</em> complex; as well as <em>Halodule uninervis</em> and <em>H. pinifolia</em>. It is the first time that <em>H. pinifolia</em> is reported in Tanzania. This is the first study reporting the delineation of seagrass species in East African coastal waters using DNA barcoding coupled with morphology.</p>
Data from: Delineating seagrass species in the genera Halodule and Halophila from Tanzanian coastal waters using ITS and rbcL DNA barcoding
Open the record for dataset details and reuse information.
Diatoms rbcL alignment and phylogeny
<p>The dataset contains:</p> <ul> <li>Reference rbcL alignment (604 sequences)</li> <li>Reference phylogeny reconstructed with RAxML (604 species)</li> </ul> <p> </p>
FIGURE 1 in Systematic position of Rivina humilis var. humilis, R. humilis var. bracteata and R. bengalensis based on nrDNA ITS and cpDNA rbcL & trnH-psbA sequence data
FIGURE 1. Best ML tree retrieved after analysing 43 taxa of family Phytolaccaceae. The best fit model of evolution GTR+G+I. The tree rooted at Hilleria latifolia (Lee et al. 2013).
FIGURE 3. A–E in Systematic position of Rivina humilis var. humilis, R. humilis var. bracteata and R. bengalensis based on nrDNA ITS and cpDNA rbcL & trnH-psbA sequence data
FIGURE 3. A–E: Rivina humilis L.var. bracteata; A) Habit (inset flowers); B) Infructescence; C) Bract; D) Fruit; E) Seed; F–J: Rivina humilis L. var. humilis; F) Habit (inset flower); G) Infructescence; H) Bract; I) Fruit; J) Seed; K–O: Rivina bengalensis S. C. Srivastava et T. K. Paul; K) Habit (inset flowers); L) Infructescence; M) Bract; N) Fruit; O) Seed.
FIGURE 4 in First occurrence of Gracilaria chilensis, and distribution of Gracilariopsis lemaneiformis (Gracilariaceae, Gracilariales) in Peru on the basis of rbcL sequence analysis
FIGURE 4. Phylogenetic tree based on rbcL sequences inferred from a maximum-likelihood analysis as implemented by RAxML. Taxa highlighted in red were newly sequenced for this study. GenBank numbers are listed after each taxon. Bootstrap proportions (>50%) for ML (1000 replicates, Left) and Bayesian Posterior Probability (Right) are shown at the nodes. Full support denoted as *.
FIGURE 3 in First occurrence of Gracilaria chilensis, and distribution of Gracilariopsis lemaneiformis (Gracilariaceae, Gracilariales) in Peru on the basis of rbcL sequence analysis
FIGURE 3. Habit of a female gametophyte of Gracilariopsis lemaneiformis from San Andres, Ica, Peru (IMARPE 05-000325).
FIGURE 2 in First occurrence of Gracilaria chilensis, and distribution of Gracilariopsis lemaneiformis (Gracilariaceae, Gracilariales) in Peru on the basis of rbcL sequence analysis
FIGURE 2. Habit of non-reproductive specimens of Gracilaria chilensis from Morro Sama, Peru. Fig. 2A. IMARPE 05-000326-1. Fig. 2B. IMARPE 05-000326-2.
FIGURE 1 in First occurrence of Gracilaria chilensis, and distribution of Gracilariopsis lemaneiformis (Gracilariaceae, Gracilariales) in Peru on the basis of rbcL sequence analysis
FIGURE 1. Distribution map of terete Gracilariaceae from Peru. Occurrence of Gracilariopsis lemaneiformis along the northern and central coast: Paita (Piura), Eten (Lambayeque), Ancon and Chorrillos (Lima), and San Andres (Ica). Also, Gracilaria chilensis from the southern coast (Sama, Tacna).
FIGURE 4. Bulbophyllum cambodianum. Two Bulbophyllum cambodianum specimens with different flower morphology. B. cambodianum I in Molecular phylogenetics of species of Bulbophyllum sect. Trias (Orchidaceae; Epidendroideae; Malaxidae) based on nrITS and plastid rbcL and matK
FIGURE 4. Bulbophyllum cambodianum. Two Bulbophyllum cambodianum specimens with different flower morphology. B. cambodianum I (A) has pale yellow flower with purple dots on the sepals, both edges of petals and proximal half of the lip, with the top sepal and the lateral sepals shapes being slightly different and the top being slightly slender than the lateral. B. cambodianum II (B), on the other hand, has equally shaped sepals, with purple dots on its flower that are slightly darker and more densely distributed in the proximal end of sepals than in the apex and having darker purple dots that cover the petals including the lip very densely with its dorsal sepal bent forward at almost a 90–degree angle.
FIGURE 1 in Molecular phylogenetics of species of Bulbophyllum sect. Trias (Orchidaceae; Epidendroideae; Malaxidae) based on nrITS and plastid rbcL and matK
FIGURE 1. Phylogenetic tree of Trias and Bulbophyllum based on nuclear ITS sequence. The Bayesian tree of Trias species, Drymoda and 32 Bulbophyllum species with five outgroup species. Numbers above branches are maximum likelihood bootstrap percentage (BP), numbers below branches are Bayesian posterior probabilities (PP). A dash (-) above branches are values below 50 BP. Clades of Trias and Bulbophyllum are indicated. Trias photographs represent vegetative morphological characters unique to each Trias clade.
FIGURE 3 in Molecular phylogenetics of species of Bulbophyllum sect. Trias (Orchidaceae; Epidendroideae; Malaxidae) based on nrITS and plastid rbcL and matK
FIGURE 3. The species tree of Trias and Bulbophyllum based on ITS and plastid matK–rbcL sequences. The species tree constructed by StatBEAST utilizing ITS, matK, and rbcL for eight Trias species, Drymoda and 18 Bulbophyllum species with four outgroup species: Dendrobium pullchellum, D. parciflorum, D. rosellum and D. mariae. Numbers above branches are posterior probabilities (PP). Clades of Trias and Bulbophyllum are indicated.
FIGURE 2 in Molecular phylogenetics of species of Bulbophyllum sect. Trias (Orchidaceae; Epidendroideae; Malaxidae) based on nrITS and plastid rbcL and matK
FIGURE 2. The phylogenetic tree of Trias and Bulbophyllum based on plastid matK–rbcL sequence. The Bayesian tree of Trias species, Drymoda and 18 Asian Bulbophyllum species with four outgroup species: Dendrobium pullchellum, D. parciflorum, D. rosellum and D. mariae. Numbers above branches are maximum likelihood bootstrap percentage (BP), numbers below branches are Bayesian posterior probabilities (PP). Clades of Trias and Bulbophyllum are indicated.
Halamphora witkowskii rbcL phylogenetic analysis files
Open the record for dataset details and reuse information.
FIGURE. Maximum clade credibility tree of a post-burnin Bayesian analysis (100 million generations), based on nuclear (agt1, ETS, g3pdh, phyC, rpb2) and plastid (atpB–rbcL, matK, rps16, ycf1 pos. 1113-2103, ycf1 pos. 4492-5440) data. Above the branches, Bayesian posterior probabilities (PP) and maximum-likelihood bootstrap support (BS) are shown (PP/BS). The scale bar below the tree shows the branch length for 0.004 substitutions per nucleotide position. Capital letters at the branches are referred to in the tree description. in Re-evaluation of the Amazonian Hylaeaicum (Bromeliaceae: Bromelioideae) based on neglected morphological traits and molecular evidence
FIGURE. Maximum clade credibility tree of a post-burnin Bayesian analysis (100 million generations), based on nuclear (agt1, ETS, g3pdh, phyC, rpb2) and plastid (atpB–rbcL, matK, rps16, ycf1 pos. 1113-2103, ycf1 pos. 4492-5440) data. Above the branches, Bayesian posterior probabilities (PP) and maximum-likelihood bootstrap support (BS) are shown (PP/BS). The scale bar below the tree shows the branch length for 0.004 substitutions per nucleotide position. Capital letters at the branches are referred to in the tree description.
rCRUX Generated rbcl (Plant RBCL7/8) Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: rbcl (Plant RBCL7/8)<br> Gene: rbcl<br> Length of Target: 180<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 150<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA<br> Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC<br> Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Dataset containing ITS2 and rbcL trimmed sequences from managed grassland plant communities
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.