rCRUX Generated Taberlet c/h trnl Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Taberlet c/h trnl<br> Gene:&nbsp; &nbsp;trnl<br> Length of Target:&nbsp; &nbsp; 150<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 150<br> blast_seeds() minimum length:&nbsp; &nbsp; 85<br> blast_seeds() maximum length:&nbsp; &nbsp; 128<br> max_to_blast:&nbsp; 100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;CGAAATCGGTAGACGCTACG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CCATTGAGTCTCTGCACCTATC<br> Reference:&nbsp; &nbsp;Taberlet, P., Gielly, L., Pautou, G., &amp; Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of. Plant molecular biology, 17, 1105-1109. &amp; Taberlet, Pierre, Eric Coissac, Fran&ccedil;ois Pompanon, Ludovic Gielly, Christian Miquel, Alice Valentini, Thierry Vermat, Gerard Corthier, Christian Brochmann, and Eske Willerslev. &quot;Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding.&quot; Nucleic acids research 35, no. 3 (2007): e14-e14.</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>