rCRUX Generated Cephalpod 18S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Ceph18S<br> Gene:&nbsp; &nbsp;18S<br> Length of Target:&nbsp; &nbsp; 150&ndash;190<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 235<br> blast_seeds() minimum length:&nbsp; &nbsp; 65<br> blast_seeds() maximum length:&nbsp; &nbsp; 195<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;CGCGGCGCTACATATTAGAC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GCACTTAACCGACCGTCGAC<br> Reference:&nbsp; &nbsp; D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021)&nbsp;<a href="https://doi.org/10.1098/rsos.201388">https://doi.org/10.1098/rsos.201388</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>