rCRUX Generated Cephalpod 18S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: Ceph18S<br> Gene: 18S<br> Length of Target: 150–190<br> get_seeds_local() minimum length: 105<br> get_seeds_local() maximum length: 235<br> blast_seeds() minimum length: 65<br> blast_seeds() maximum length: 195<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CGCGGCGCTACATATTAGAC<br> Reverse Sequence (5'-3'): GCACTTAACCGACCGTCGAC<br> Reference: D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021) <a href="https://doi.org/10.1098/rsos.201388">https://doi.org/10.1098/rsos.201388</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
ShareScore
40/100
Overall dataset sharing score
Score breakdown
These five areas show where the dataset supports — or may limit — practical reuse.
- Stewardship
- 8
- Harmonization
- 4
- Access
- 16
- Reuse readiness
- 8
- Engagement
- 4