rCRUX Generated Ford Fish 16S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Ford Fish 16S<br> Gene:&nbsp; &nbsp;16S<br> Length of Target:&nbsp; &nbsp; 330<br> get_seeds_local() minimum length:&nbsp; &nbsp; 279<br> get_seeds_local() maximum length:&nbsp; &nbsp; 477<br> blast_seeds() minimum length:&nbsp; &nbsp; 231<br> blast_seeds() maximum length:&nbsp; &nbsp; 429<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GGATTGCGCTGTTATCCCTA<br> Reference:&nbsp; &nbsp; Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population&rsquo;s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>