rCRUX Generated MiDeca Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; MiDeca<br> Gene:&nbsp; &nbsp;16S<br> Length of Target:&nbsp; &nbsp; 154-184<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 230<br> blast_seeds() minimum length:&nbsp; &nbsp; 66<br> blast_seeds() maximum length:&nbsp; &nbsp; 191<br> max_to_blast:&nbsp; 50<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GGACGATAAGACCCTATAAA<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; ACGCTGTTATCCCTAAAGT<br> Reference:&nbsp; &nbsp;Komai, T., Gotoh, R.O., Sado, T. and Miya, M., 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. Metabarcoding and Metagenomics, 3, p.e33835.&nbsp;https://doi.org/10.3897/mbmg.6.76534</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>