rCRUX Generated MiFish Universal 12S Expanded Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
ShareScore
40/100
Overall dataset sharing score
Score breakdown
These five areas show where the dataset supports — or may limit — practical reuse.
- Stewardship
- 8
- Harmonization
- 4
- Access
- 16
- Reuse readiness
- 8
- Engagement
- 4