Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
7
datasets available to search
ShareScore release 0.9.0
Dataset results
7 results for “MiFish”
rCRUX Generated MiFish Universal 12S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in January 2024.</p> <p>Primer Name: MiFish Universal<br>Gene: 12S<br>Length of Target: 163–185<br>get_seeds_local() minimum length: 170<br>get_seeds_local() maximum length: 400<br>blast_seeds() minimum length: 140<br>blast_seeds() maximum length: 400<br>max_to_blast: 1000<br>Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br>Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br>Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p> <p>This project was funded by the NOAA 'Omics Program.</p>
rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 .</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p>
rCRUX Generated MiFish Universal 12S Expanded Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
rCRUX Generated MiFish Universal 12S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Data from: MiFish data from river and sea water concentrated using glass fiber filters, Sterivex, and QuickConc
Open the record for dataset details and reuse information.
Data from: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species
We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.
Data from: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.