Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
6,225
datasets available to search
ShareScore release 0.9.0
Dataset results
6,225 results for “expression analysis”
Data from: Genomic identification, characterization and differential expression analysis of SBP-box gene family in Brassica napus
Background: SBP-box genes belong to one of the largest families of transcription factors. Though members of this family have been characterized to be important regulators of diverse biological processes, information of SBP-box genes in the third most important oilseed crop Brassica napus is largely undefined. Results: In the present study, by whole genome bioinformatics analysis and transcriptional profiling, 58 putative members of SBP-box gene family in oilseed rape (Brassica napus L.) were identified and their expression pattern in different tissues as well as possible interaction with miRNAs were analyzed. In addition, B. napus lines with contrasting branch angle were used for investigating the involvement of SBP-box genes in plant architecture regulation. Detailed gene information, including genomic organization, structural feature, conserved domain and phylogenetic relationship of the genes were systematically characterized. By phylogenetic analysis, BnaSBP proteins were classified into eight distinct groups representing the clear orthologous relationships to their family members in Arabidopsis and rice. Expression analysis in twelve tissues including vegetative and reproductive organs showed different expression patterns among the SBP-box genes and a number of the genes exhibit tissue specific expression, indicating their diverse functions involved in the developmental process. Forty-four SBP-box genes were ascertained to contain the putative miR156 binding site, with 30 and 14 of the genes targeted by miR156 at the coding and 3′UTR region, respectively. Relative expression level of miR156 is varied across tissues. Different expression pattern of some BnaSBP genes and the negative correlation of transcription levels between miR156 and its target BnaSBP gene were observed in lines with different branch angle. Conclusions: Taken together, this study represents the first systematic analysis of the SBP-box gene family in Brassica napus. The data presented here provides base foundation for understanding the crucial roles of BnaSBP genes in plant development and other biological processes.
Data from: Determinants and co-expression of anti-predator responses in amphibian tadpoles: a meta-analysis
A wide range of taxa respond to perceived predation risk (PPR) through inducible defenses, and many prey are capable of responding both behaviorally and morphologically to the same risk event. In cases where multiple defenses confer protection by independent means (i.e., they are mechanistically independent) responses will either be co-expressed, or the expression of one defense will limit the capacity (or need) to respond along another axis. Our ability to generate a broad understanding of these patters has been limited, in part, by difficulties in comparing results across studies that employ distinct experimental protocols. Using the extensive literature on tadpole responses to PPR, we conducted a meta-analysis to identify the ecological and experimental determinants of inducible defence expression. We then assessed whether the magnitude of response to PPR along behavioural versus morphological response axes was positively, or negatively, correlated. The most commonly quantified responses to perceived risk in tadpoles included reductions in movement and swimming behaviour, and altered tail morphology. Our analyses reveal that tadpole behavioural responses are strongly influenced by prey family, predator taxon, evolutionary history with the predator (native vs. non-native), amount of prey consumed by the predator, and how perceived risk was manipulated (e.g., presence vs. absence of alarm cues). Tail morphology was similarly influenced by these factors, but also whether the target prey was palatable to predators. Thus, our results identify ecological and experimental features that critically influence the observed effect size in tadpole responses to PPR. A positive correlation between behavioural and morphological responses in studies where both were measured indicates that trait co-specialization is the predominant pattern of defense deployment in larval amphibians. This positive relationship suggests that survival tends to be maximized in tadpoles through equivalent coactivation of multiple independent axes of protection, opposed to maximal expression along any single axis.
Gene expression analysis of KRAS knockout pancreatic cancer cell line CFPAC1
<p>We used CRISPR to inactivate mutant KRAS in CFPAC1 (KRASG12V) pancreatic cancer cell lines. Gene expression analysis of KRAS intact vs. knockout cells identified sets of genes involved in protein synthesis, cell differentiation, and metabolic processes, while the expression of MAPK/ERK target genes remained unperturbed.</p>
Data for qualitative analysis of Expressive Writings
Open the record for dataset details and reuse information.
Expression Pattern and Potential Functional Sites Analysis of ALOX12B Gene in Sheep Horn
Open the record for dataset details and reuse information.
Curated RNA Sequencing Data for Zebrafish (Danio rerio) snoRNA Expression Analysis
Open the record for dataset details and reuse information.
Global gene expression analysis of Streptococcus agalactiae at exponential growth phase_Table 2
<p>Top-100 most expressed genes by functional category.</p>
mRNA expression analysis of the hippocampus in a Vervet monkey model of FASD
<p>The vervet monkey (<i>Chlorocebus </i>aethiops) has proven to be an invaluable tool for researching voluntary alcohol ingestion and the sequelae that can arise from such behaviour. In this study, a vervet monkey model for fetal alcohol spectrum disorder was generated by providing a cohort of alcohol preferring, pregnant dams the option to ingest alcohol between gestational days 90-165 with a corresponding sucrose matched control group. Subsequently, gene expression analysis of the hippocampus was contrasted at 5 months and 2 years using the GeneChip Rhesus Macaque Genome Array in a 2x2 study design which interrogated two independent variables, Age and Alcohol consumption. The analysis identified a global downregulation of expression when interrogating Alcohol as a main effect with a relative balance of upregulation and downregulation using Age as a main effect. Functional annotation of both independent variables was performed with Alcohol generating broad functional annotation clusters which could implicate an epigenetic role in downregulation, while Age reliably produced functional annotation clusters predominantly related to development. Furthermore, our data reveal a novel connection between <i>EFNB1</i> and FASD which is highly plausible given its role in development as well as its central role in craniofrontal nasal syndrome (CFNS).</p>
Expression proteomics and histone analysis reveals extensive chromatin network changes and a role for histone tail trimming during cellular differentiation
Open the record for dataset details and reuse information.
ANALYSIS OF ENGLISH TRANSLATIONS OF LEXEMAS OF MEASUREMENT UNITS EXPRESSING MONETARY VALUE IN "BOBURNOMA"
Open the record for dataset details and reuse information.
Dataset for the analysis in "Purifying selection on deleterious variants affected by the combination of subgenomes and gene expression in common wheat"
<p>Multiple alignment files including outgroups used for the evolutionary genomics conducted in the research paper, Purifying selection on deleterious variants affected by the combination of subgenomes and gene expression in common wheat. The compressed file size is 164.6 MB and will be 2.98 GB after decompression.</p>
Dataset for biochemical assays and gene expression analysis
Open the record for dataset details and reuse information.
Table 3 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 3</b> Effect of different plant growth regulators on induction of somatic embryos in three pistachio genotypes' explants (immature zygotic embryos) under light condition.</p><table><tbody><tr><th></th><th>Induction of somatic embryos %</th><th></th><th>Number of embryos/explant</th><th></th></tr></tbody><tbody><tr><th></th><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td></tr><tr><th>E1</th><td>23.22 ± 3.39 c</td><td>22.74 ± 1.46d</td><td>24.67 ± 1.45 c</td><td>4.3 ± 1.2b</td><td>12.33 ± 1.45b</td><td>8 ± 0.58b</td></tr><tr><th>E2</th><td>34.25 ± 0.92b</td><td>34.66 ± 0.22 c</td><td>35.31 ± 0.85b</td><td>12.33 ± 1.45a</td><td>45 ± 2.88 a</td><td>11.33 ± 1.45a</td></tr><tr><th>E6</th><td>43.75 ± 3.6ab</td><td>43.58 ± 0.87b</td><td>42.83 ± 2.80a</td><td>5.33 ± 0.88b</td><td>10 ± 1.15b</td><td>7.67 ± 0.88b</td></tr><tr><th>E11</th><td>50.00 ± 4.12a</td><td>49.95 ± 1.19a</td><td>48.67 ± 2.03a</td><td>4.67 ± 0.88b</td><td>9.33 ± 1.20b</td><td>6 ± 0.58b</td></tr></tbody></table><p>Data within a column followed by different letters indicate significantly differences according to the LSD test at p <.05.</p>
Table 2 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 2</b> PCR primer sequences of selected somatic embryogenesis-related genes for qRT in pistachio.</p><table><tbody><tr><th>Gene name</th><th>Forward primer sequence 5′-3′</th><th>Reverse primer sequence 5′-3′</th><th>Tm (̊C)</th><th>Amplicon length (bp)</th></tr></tbody><tbody><tr><th><i>ACT</i></th><td>GTATCCACGAGACCACCTACA</td><td>GGAGCAACGACCTTGATCTTC</td><td>60</td><td>157</td></tr><tr><th><i>AGL15</i></th><td>GGAGCAATCAAGAGTACAGGAACAG</td><td>CACTTCAGGACTTGCAGAACTATGG</td><td>60</td><td>187</td></tr><tr><th><i>LEC</i></th><td>GATGTGGGGTCTCTTGGAAGGA</td><td>AGCCTGTTTTGCTTTACGAAATCTC</td><td>60</td><td>209</td></tr><tr><th><i>BBM</i></th><td>TCCCAATTAGCAACTACGAGAAAGAG</td><td>CTGATGATGCCTTGTAACACCAC</td><td>60</td><td>140</td></tr><tr><th><i>PKL</i></th><td>GTAGACATCGCACCCTCTTAACTG</td><td>GAGCCAGCATTTTATGAAGTCTTGA</td><td>60</td><td>174</td></tr></tbody></table>
Table 1 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 1</b> Summary of different responses of zygotic immature embryos to different basal medium (BM1 and BM2), combination and concentration of plant growth regulators (PGRs), and light and dark conditions.The response of explants was in the form of callus (C), somatic embryogenesis (SE), and adventitious shoot (AS).The Basal media were BM1: MS mineral salts,B5 vitamins, 30 g L <i>−</i> 1 sucrose, BM2: half strength MS macro salts, B5 vitamins, 100 mg L <i>−</i> 1 L-glutamine, 500 mg L <i>−</i> 1 casein hydrolysate, and 30 g L <i>−</i> 1 sucrose.</p><table><tbody><tr><th>Coding</th><th>PGRs combinations (mg L <i>−</i> 1)</th><th>Light</th><th>Dark</th></tr></tbody><tbody><tr><th></th><td></td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td></tr><tr><th></th><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td></tr><tr><th>E1</th><td>0</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E2</th><td>0.01 IBA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E3</th><td>0.01 IBA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E4</th><td>0.01 IBA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr><tr><th>E5</th><td>0.01 IBA + 3 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E6</th><td>0.01 2,4-D</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E7</th><td>0.01 2,4-D + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E8</th><td>0.01 2,4-D + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E9</th><td>0.01 2,4-D + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E10</th><td>0.01 2,4-D + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E11</th><td>0.01 NAA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E12</th><td>0.01 NAA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E13</th><td>0.01 NAA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E14</th><td>0.01 IBA + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E15</th><td>0.01 IBA + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E16</th><td>0.01 IBA + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E17</th><td>0.01 IBA + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr></tbody></table><p>«–» and « + » represent nonexistence and existence the response on explants that cultured in intended media, respectively.</p>
Computational Analysis, In silico Functional Annotation, and Expression of Recombinant Mycobacterium PE_PGRS Protein Biomarkers
<p>Data set for bioinformatics predictions and expression profiles.</p> <p> </p>
Gene Expression Profiles in Generalized Aggressive Periodontitis: A Gene Network-based Microarray Analysis
ClinicalTrials.gov study NCT02327533. IPD Sharing: Not stated. Countries: 0. Publications: 3.
Expression Analysis of Specific Markers in Non-small Cell Lung Cancer or Melanoma
ClinicalTrials.gov study NCT00685750. IPD Sharing: Not stated. Countries: 5. Publications: 0.
Sorafenib Tosylate and Gene Expression Analysis in Patients Undergoing Surgery For High-Risk Localized Prostate Cancer
ClinicalTrials.gov study NCT00466752. IPD Sharing: Not stated. Countries: 1. Publications: 0.
Hormone Therapy Or Chemotherapy Before Surgery Based on Gene Expression Analysis in Treating Patients With Breast Cancer
ClinicalTrials.gov study NCT01293032. IPD Sharing: YES. Countries: 2. Publications: 0.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.