Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
865
datasets available to search
ShareScore release 0.7.1
Dataset results
865 results for “mitochondrial genome”
FIGURE 7 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 7. Features present in the A+T-rich region of Smerinthus planus. The ATATG motif is yellow shaded. The poly-T stretch is dotted underlined while the poly-A stretch is underlined. The single microsatellite T/A repeat sequence is indicated by gray shaded.
FIGURE 5 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 5. Putative secondary structures of the 22 tRNA genes of the Smerinthus planus mitochondrial genome.
FIGURE 6 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 6. Sequence alignment of PCG and tRNA regions from 27 different Lepidoptera species. 6A, The color sequence part is motif AAGATAGAAACCAACCTGGCTYACACCGGTTTGAACTCAGATCATGTAAG; 6B, The color sequence part is motif GAAGAATGAACTAAAGCAGAAACWGGAGTWGGAGCWGCTATAGCWGCWGG; 6C, The color sequence part is motif AAYCCWGAAACTAATTCTCTTTCHCCTTCAGCAAAATCAAAAGGAGTWCG.
FIGURE 4. A in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 4. A. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of 31 species in the Lepidoptera. Codon families are plotted on the X axis. B. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of S. planus in the Lepidoptera. Codon families are plotted on the X axis.
FIGURE 2 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 2. Comparison of the codon usage patterns within the mitochondrial genome of different Lepidoptera species.
FIGURE 3 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 3. Codon distribution patterns in various Lepidoptera species. The y-coordinate is the proportion of codons per 100 codons.
FIGURE 1 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 1. Map of the mitogenome of S. planus. The tRNA genes are labeled according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 refer to the cytochrome c oxidase subunits; cob refers to cytochrome b; nad1-nad6 refer to NADH dehydrogenase components; rrnL and rrnS refer to ribosomal RNAs. Gene named above the bar are located on major strand, while the others are located on minor strand.
Data from: Ancient mitochondrial genomes clarify the evolutionary history of New Zealand's enigmatic acanthisittid wrens
The New Zealand acanthisittid wrens are the sister-taxon to all other "perching birds" (Passeriformes) and – including recently extinct species – represent the most diverse endemic passerine family in New Zealand. Consequently, they are important for understanding both the early evolution of Passeriformes and the New Zealand biota. However, five of the seven species have become extinct since the arrival of humans in New Zealand, complicating evolutionary analyses. The results of morphological analyses have been largely equivocal, and no comprehensive genetic analysis of Acanthisittidae has been undertaken. We present novel mitochondrial genome sequences from four acanthisittid species (three extinct, one extant), allowing us to resolve the phylogeny and revise the taxonomy of acanthisittids. Reanalysis of morphological data in light of our genetic results confirms a close relationship between the extant rifleman (Acanthisitta chloris) and an extinct Miocene wren (Kuiornis indicator), making Kuiornis a useful calibration point for molecular dating of passerines. Our molecular dating analyses reveal that the stout-legged wrens (Pachyplichas) diverged relatively recently from a more gracile (Xenicus-like) ancestor. Further, our results suggest a possible Early Oligocene origin of the basal Lyall's wren (Traversia) lineage, which would imply that Acanthisittidae survived the Oligocene marine inundation of New Zealand and therefore that the inundation was not complete.
Data from: Mitochondrial genomes of Australian chicken Eimeria support the presence of ten species with low genetic diversity among strains
Modern molecular approaches have vastly improved diagnostic capabilities for differentiating among species of chicken infecting Eimeria. Consolidating information from multiple genetic markers, adding additional poultry Eimeria species and increasing the size of available data-sets is improving the resolving power of the DNA, and consequently our understanding of the genus. This study adds information from 25 complete mitochondrial DNA genomes from Australian chicken Eimeria isolates representing all 10 species known to occur in Australia, including OTU-X, −Y and −Z. The resulting phylogeny provides a comprehensive view of species relatedness highlighting where the OTUs align with respect to others members of the genus. All three OTUs fall within the Eimeria clade that contains only chicken-infecting species with close affinities to E. maxima, E. brunetti and E. mitis. Mitochondrial genetic diversity was low among Australian isolates likely reflecting their recent introduction to the country post-European settlement. The lack of observed genetic diversity is a promising outcome as it suggests that the currently used live vaccines should continue to offer widespread protection against Eimeria outbreaks in all states and territories. Flocks were frequently found to host multiple strains of the same species, a factor that should be considered when studying disease epidemiology in the field.
Data from: Complete mitochondrial genome of the poorly known Amur sculpin Mesocottus haitej (Cottoidei: Cottidae)
The complete mitochondrial genome sequence of Mesocottus haitej has been obtained by the next generation sequencing, which contained 22 tRNA genes, 13 protein-coding genes, 2 rRNA genes and non-coding control region with the total length of 16,527 bp. The gene content, arrangement, codon usage and base composition of M. haitej mitogenome have no unusual features that distinguish it from most other teleost fishes. According to the result of a pilot phylogenetic analysis, the freshwater Mesocottus is a sister lineage to the Cottus clade. The new mitogenomic data could provide useful information for the further studies on molecular systematics and conservation genetics of cottids.
Data from: The complete sequence of the mitochondrial genome of Butomus umbellatus - a member of an early branching lineage of monocotyledons
In order to study the evolution of mitochondrial genomes in the early branching lineages of the monocotyledons, i.e., the Acorales and Alismatales, we are sequencing complete genomes from a suite of key taxa. As a starting point the present paper describes the mitochondrial genome of Butomus umbellatus (Butomaceae) based on next-generation sequencing data. The genome was assembled into a circular molecule, 450,826 bp in length. Coding sequences cover only 8.2% of the genome and include 28 protein coding genes, four rRNA genes, and 12 tRNA genes. Some of the tRNA genes and a 16S rRNA gene are transferred from the plastid genome. However, the total amount of recognized plastid sequences in the mitochondrial genome is only 1.5% and the amount of DNA transferred from the nucleus is also low. RNA editing is abundant and a total of 557 edited sites are predicted in the protein coding genes. Compared to the 40 angiosperm mitochondrial genomes sequenced to date, the GC content of the Butomus genome is uniquely high (49.1%). The overall similarity between the mitochondrial genomes of Butomus and Spirodela (Araceae), the closest relative yet sequenced, is low (less than 20%), and the two genomes differ in size by a factor 2. Gene order is also largely unconserved. However, based on its phylogenetic position within the core alismatids Butomus will serve as a good reference point for subsequent studies in the early branching lineages of the monocotyledons.
Data from: Elevated mitochondrial genome variation after 50 generations of radiation exposure in a wild rodent
Currently, the effects of chronic, continuous low dose environmental irradiation on the mitochondrial genome of resident small mammals are unknown. Using the bank vole (Myodes glareolus) as a model system, we tested the hypothesis that approximately 50 generations of exposure to the Chernobyl environment has significantly altered genetic diversity of the mitochondrial genome. Using deep sequencing, we compared mitochondrial genomes from 131 individuals from reference sites with radioactive contamination comparable to that present in Northern Ukraine before the April 26, 1986 meltdown, to populations where substantial fallout was deposited following the nuclear accident. Population genetic variables revealed significant differences among populations from contaminated and uncontaminated localities. Therefore, we rejected the null hypothesis of no significant genetic effect from 50 generations of exposure to the environment created by the Chernobyl meltdown. Samples from contaminated localities exhibited significantly higher numbers of haplotypes and polymorphic loci, elevated genetic diversity, and a significantly higher average number of substitutions-per-site across mitochondrial gene regions. Observed genetic variation was dominated by synonymous mutations, which may indicate a history of purify selection against nonsynonymous or insertion/deletion mutations. These significant differences were not attributable to sample size artifacts. The observed increase in mitochondrial genomic diversity in voles from radioactive sites is consistent with the possibility that chronic, continuous irradiation resulting from the Chernobyl disaster has produced an accelerated mutation rate in this species over the last 25 years. Our results, being the first to demonstrate this phenomenon in a wild mammalian species, are important for understanding genetic consequences of exposure to low-dose radiation sources.
Data from: "Complete mitochondrial and partial nuclear genomes for the jack species Caranx ignobilis (Forsskål, 1775) and C. melampygus (Cuvier, 1833) (Perciformes:Carangidae) from the High Hawaiian Islands" in Genomic Resources Notes accepted 1 October 2013 – 30 November 2013
Complete mitochondrial and partial nuclear genomes for the jack species Caranx ignobilis (Forsskål, 1775) and C. melampygus (Cuvier, 1833) (Perciformes:Carangidae) from the High Hawaiian Islands are presented along with annotation and characterization of intragenomic single nucleotide polymorphism (SNPs) and indel variation.
Data from: Tunicate mitogenomics and phylogenetics: peculiarities of the Herdmania momus mitochondrial genome and support for the new chordate phylogeny
BACKGROUND: Tunicates represent a key metazoan group as the sister-group of vertebrates within chordates. The six complete mitochondrial genomes available so far for tunicates have revealed distinctive features. Extensive gene rearrangements and particularly high evolutionary rates have been evidenced with regard to other chordates. This peculiar evolutionary dynamics has hampered the reconstruction of tunicate phylogenetic relationships within chordates based on mitogenomic data. RESULTS: In order to further understand the atypical evolutionary dynamics of the mitochondrial genome of tunicates, we determined the complete sequence of the solitary ascidian Herdmania momus. This genome from a stolidobranch ascidian presents the typical tunicate gene content with 13 protein-coding genes, 2 rRNAs and 24 tRNAs which are all encoded on the same strand. However, it also presents a novel gene arrangement, highlighting the extreme plasticity of gene order observed in tunicate mitochondrial genomes. Probabilistic phylogenetic inferences were conducted on the concatenation of the 13 mitochondrial protein-coding genes from representatives of major metazoan phyla. We show that whereas standard homogeneous amino acid models support an artefactual sister position of tunicates relative to all other bilaterians, the CAT and CAT+BP site- and time-heterogeneous mixture models place tunicates as the sister-group of vertebrates within monophyletic chordates. Moreover, the reference phylogeny indicates that tunicate mitochondrial genomes have experienced a drastic acceleration in their evolutionary rate that equally affects protein-coding and ribosomal-RNA genes. CONCLUSION: This is the first mitogenomic study supporting the new chordate phylogeny revealed by recent phylogenomic analyses. It illustrates the beneficial effects of an increased taxon sampling coupled with the use of more realistic amino acid substitution models for the reconstruction of animal phylogeny.
Data from: Evolutionary history of chimpanzees inferred from complete mitochondrial genomes
Investigations into the evolutionary history of the common chimpanzee, Pan troglodytes, have produced inconsistent results, due to differences in the types of molecular data considered, the model assumptions employed, and the quantity and geographical range of samples used. We amplified and sequenced 24 complete P. troglodytes mitochondrial genomes from fecal samples collected at multiple study sites throughout sub-Saharan Africa. Using a 'relaxed molecular clock,' fossil calibrations, and 12 additional complete primate mitochondrial genomes, we analyzed the pattern and timing of primate diversification in a Bayesian framework. Our results support the recognition of four chimpanzee subspecies. Within P. troglodytes, we report a mean (95% highest posterior density (HPD)) time since most recent common ancestor (tMRCA) of 1.026 (0.811-1.263) MYA for the four proposed subspecies, with two major lineages. One of these lineages (tMRCA = 0.510 [0.387-0.650] MYA) contains P. t. verus (tMRCA = 0.155 [0.101-0.213] MYA) and P. t. ellioti (formerly P. t. vellerosus; tMRCA = 0.157 [0.102-0.215] MYA), both of which are monophyletic. The other major lineage contains P. t. schweinfurthii (tMRCA = 0.111 [0.077-0.146] MYA), a monophyletic clade nested within the P. t. troglodytes lineage (tMRCA = 0.380 [0.296-0.476] ¬MYA). We utilized two analysis techniques that may be of widespread interest. First, we implemented a Yule speciation prior across the entire primate tree with separate coalescent priors on each of the chimpanzee subspecies. The validity of this approach was confirmed by estimates based on more traditional techniques. We also suggest that accurate tMRCA estimates from large, computationally difficult sequence alignments may be obtained by implementing our novel method of bootstrapping smaller, randomly sub-sampled alignments.
Data from: Evolutionary relationships within the Triops (Notostraca: Branchiopoda) using complete mitochondrial genomes
The tadpole shrimp (Notostraca: Triops) have been called living fossils with conserved morphology, but subtle morphological variations within and between species has yielded confused taxonomic assignments. To aid in cryptic species detection of tadpole shrimp from southern New Mexico, USA, the first complete mitochondrial genomes for three putative species (T. longicaudatus "long," T. l. "short," T. newberryi) are reported. The genomes ranged in length from 15,058 bp to 15,060 bp with 13 coding genes, 22 tRNA genes, 2 rRNA genes and a control region. Phylogenetic trees were constructed using previously sequenced Triops-genomes to assess genetic relationships within the genus. The T. longicaudatus-genomes from Genbank were consistent with our genomes for T. newberryi and T. l. "short." Variation in mitochondrial genes were identified that will aid future identification of cryptic lineages of tadpole shrimp. Genetic differentiation among the genomes of Triops in New Mexico support elevation to species status.
FIGURE 5 in Complete mitochondrial genome of a Neotropical dobsonfly Chloronia mirifica Navás, 1925 (Megaloptera: Corydalidae), with phylogenetic implications for the genus Chloronia Banks, 1908
FIGURE 5. Phylogenetic relationships among the dobsonfly genera inferred from mt genome sequences. Numbers at the nodes are Bayesian posterior probabilities (left) and ML bootstrap values (right).
FIGURE 3 in Complete mitochondrial genome of a Neotropical dobsonfly Chloronia mirifica Navás, 1925 (Megaloptera: Corydalidae), with phylogenetic implications for the genus Chloronia Banks, 1908
FIGURE 3. Predicted secondary structure of the rnnL in the Chloronia mirifica mt genome. Roman numerals denote the conserved domain structure. Dash (-) indicates Watson-Crick base pairing and dot () indicates G-U base pairing.
FIGURE 1 in Complete mitochondrial genome of a Neotropical dobsonfly Chloronia mirifica Navás, 1925 (Megaloptera: Corydalidae), with phylogenetic implications for the genus Chloronia Banks, 1908
FIGURE 1. Mitochondrial map of Chloronia mirifica. Circular maps were drawn with CGView (Grant et al. 2008). The arrows indicated the orientation of gene transcription. The tRNAs are denoted by the color blocks and are labelled according to the IUPACIUB single-letter amino acid codes (L1: UUR; L2: CNU; S1: AGN; S2: UCN). The GC content was plotted using a black sliding window, as the deviation from the average GC content of the entire sequence. GC-skew was plotted as the deviation from the average GC-skew of the entire sequence. The inner cycle indicated the location of the genes in the mt genome.
FIGURE 2 in Complete mitochondrial genome of a Neotropical dobsonfly Chloronia mirifica Navás, 1925 (Megaloptera: Corydalidae), with phylogenetic implications for the genus Chloronia Banks, 1908
FIGURE 2. Inferred secondary structure of 22 tRNAs in the Chloronia mirifica mt genome. Most tRNAs are labeled with the abbreviations of their corresponding amino acids. Dash (-) indicates Watson-Crick bonds and dot () indicates GU bonds.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.