Find research datasets worth reusing

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

FIG. 6 in Larval tapeworms (Platyhelminthes, Cestoda) from sciaenid fishes of the southern coast of Brazil

FIG. 6. — Dasyrhynchus pacificus Robinson, 1965; A, larva in toto; B, portion of the chainette; C, posterior portion of bulbs and appendix; D, half spiral of principal hooks, intercalary hooks (in black) and chainette (c). Scale bars: A, 0.1 mm; B, D, 0.05 mm;

FIG. 1 in Larval tapeworms (Platyhelminthes, Cestoda) from sciaenid fishes of the southern coast of Brazil

FIG. 1. — Heteronybelinia nipponica (Yamaguti, 1952); A, larva in toto; B, bothridium; C, basal armature; D, hooks of the first seven

FIG. 5 in Larval tapeworms (Platyhelminthes, Cestoda) from sciaenid fishes of the southern coast of Brazil

FIG. 5. — Progrillotia dollfusi Carvajal & Rego, 1983; A, metabasal armature, antibothridial face; B, basal armature, antibothridial face; C, metabasal armature, external face; D, basal armature, external face. Abbreviations: mh, microhooks; hh, hastiform hooks. Abbreviations: 1-4, falciform hooks of principal row half spiral of metabasal armature in the antibothridial face; 1'-4', in the bothridial face; a-c, intercalar hooks in the antibothridial face; a'-c', in the bothridial face; Bb, Bc, Bd, Be, uncinate hooks of basal armature.

FIG. 3. — A, B in Larval tapeworms (Platyhelminthes, Cestoda) from sciaenid fishes of the southern coast of Brazil

FIG. 3. — A, B, Nybelinia bisulcata (Linton, 1889); A, larva in toto; B, basal armature; C, D, Dollfusiella sp.; C, larva in toto; D, hooks

FIG. 2. — A-C, Heteronybelinia annakohnae n in Larval tapeworms (Platyhelminthes, Cestoda) from sciaenid fishes of the southern coast of Brazil

FIG. 2. — A-C, Heteronybelinia annakohnae n. sp.; A, larva in toto; B, hooks of the first rows of the tentacles; C, basal and metabasal armature; D-F Heteronybelinia estigmena (Dollfus, 1960); D, Larva in toto; E, basal armature; F, hooks of the first rows of the

FIG. 4 in Larval tapeworms (Platyhelminthes, Cestoda) from sciaenid fishes of the southern coast of Brazil

FIG. 4. — Progrillotia dollfusi Carvajal & Rego, 1983; A, larva in toto; B, longitudinal section of the bulb showing implantation of the retrator muscle (rm) in the tentacle and glandular cells (gc) (schematic); C, internal face, metabasal armature; D, internal face, basal armature. Abbreviations: 1-4, falciform hooks of principal row half spiral of metabasal armature in the antibothridial face; 1'-3', in the bothridial face; a, b, intercalar hooks in the antibothridial face; a', b', in the bothridial face; Ba, Bb, Be, uncinate hooks of basal

FIG. 7. — A, B in Larval tapeworms (Platyhelminthes, Cestoda) from sciaenid fishes of the southern coast of Brazil

FIG. 7. — A, B, unidentified procercoid larva; A, larva in toto; B, same with retracted cercomer; C, D, unidentified plerocercoid larva;

FIG. 8. — Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 8. — Temnosewellia vietnamensis n. sp., the cirrus introvert observed with the Nomarski differential interference contrast (DIC) microscopy showing the unspined distal region. Abbreviations: s, stylet; si, spined introvert; udr, unspined distal region. Scale bar: 50 μm.

FIG. 5. — Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 5. — Temnosewellia vietnamensis n. sp., egg capsules: A, B, general views (binocular microscope); C-F, details of the opercular plates (SEM). White arrowheads show the opercular plates; black arrowheads show the filament. Scale bars: 100 μm.

FIG. 4. — A, B, Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 4. — A, B, Temnosewellia vietnamensis n. sp., specimen frontally sectioned showing the arrangement and size of the genital structures, comprised between the posterior testicles, posterior wall of the intestine and the adhesive disc, and the conspicuous vesicula resorbens indenting the intestinal wall. Abbreviations: ad, adhesive disk; c, cirrus; ga, genital atrium; i, intestine, o, ovary; pt, posterior testicle, vd, vasa deferentia; vr vesicula resorbens. Scale bars: 200 μm.

FIG. 3. — Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 3. — Temnosewellia vietnamensis n. sp.: A, B, SEM micrographs of whole specimens; C-E, details of the syncytial plates; F, detail of the gonopore. Black arrowheads show excretory pore, white arrowheads show the border of the postentacular and body syncytial plates. Scale bars: A, 200 μm; B, 500 μm; C, D, 50 μm; E, 100 μm; F, 20 μm.

FIG. 9. — Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 9. — Temnosewellia vietnamensis n. sp., cirrus seen with SEM: A, detail of the introvert; B, detail of the thickened ring; C, frontal view of the introvert; D, detail of the rows of spines and their insertion points. White arrowheads show the thickened ring. Scale bars: A, 10 μm; B, 2 μm; C, D, 5 μm.

FIG. 1. — Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 1. — Temnosewellia vietnamensis n. sp.: A, drawing of a specimen in ventral view; B, reconstruction of the male and female genital systems. Abbrevations: at, anterior testicle; c, cirrus; e, eye; ea, excretory ampullae; es, ejaculatory sac; g, glands; ga, genital atrium; go, gonopore; hc, Haswell's cells; i, intestine; o, ovary; pb, prostatic bulb; pt, posterior testicle; rg, rhabdite glands; sgt, shell glands tracts; sr, seminal receptacle; sv, seminal vesicle; v, vitellaria; va, vagina; vr vesicula resorbens. Scale bars: A, 1000 μm; B, 300 μm.

FIG. 7. — Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 7. — Temnosewellia vietnamensis n. sp., the cirrus introvert observed in different focusing planes with the Nomarski differential interference contrast (DIC) microscopy. Focus series captured from the top left hand corner to the bottom right hand corner. Scale bar: 25 μm.

FIG. 6. — Temnosewellia vietnamensis n in A new species of Temnosewellia (Platyhelminthes, Temnocephalida) ectosymbiont on Villopotamon thaii (Crustacea, Decapoda, Potamidae) from Vietnam

FIG. 6. — Temnosewellia vietnamensis n. sp., cirrus, detail of the distal extremity (A) and general view (B). Scale bars: 100 μm.