Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
6,335
datasets available to search
ShareScore release 0.9.0
Dataset results
6,335 results for “direct”
Figure 10 in Paracossulus thrips (Hübner, 1818) (Cossidae) and Lignyoptera fumidaria (Hübner, 1825) (Geometridae) - two Lepidoptera genera new for Serbia with a review of the distribution of these two Habitats Directive species in the Balkan Peninsula
Figure 10. Distribution of Paracossulus thrips in the Balkan Peninsula. Red dots represent the new localities; black dots – published localities; yellow dot – false published locality.
Figure 2 in Human induced trauma and directed take inhibits sea turtle recovery in the Commonwealth of the Northern Mariana Islands
Figure 2. Total number of green (Chelonia mydas), hawksbill (Eretmochelys imbricata), and olive ridley (Lepidochelys olivacea) and unknown sea turtle recoveries per year represented in the CNMI stranding database 2005 to 2016 (n = 89).
Data from "Analyzing Emulsion Dynamics via Direct Visualization and Statistical Methodologies"
<p>The data used in "<strong>Analyzing Emulsion Dynamics via Direct Visualization and Statistical Methodologies</strong>".</p>
CREATIVE ACTIVITY IN PREPARING PRIMARY CLASS TEACHERS TO DIRECT NATIONAL PROFESSIONS
Open the record for dataset details and reuse information.
Opaque dry front moving in the direction of the air which is conveyed through the alcogel-lined capillary.
Open the record for dataset details and reuse information.
Source Data for "Direct Visualization of Relativistic Quantum Scars"
Open the record for dataset details and reuse information.
Impact of Automated Port Operations on Landslide Freight Corridor Performance: Opportunities, Barriers, and Future Directions with the Port of Long Beach
Open the record for dataset details and reuse information.
Clozapine Sensing Through Paper-based Microfluidic Sensors Directly Modified via Electrodeposition and Electropolymerization
Open the record for dataset details and reuse information.
Emulator of PR-DNS: Part II, dataset for training the emulator of thermodynamics and cloud droplet fields in Particle-Resolved Direct Numerical Simulation
Open the record for dataset details and reuse information.
Multi-Path Direct Current Spinal Stimulation Extended Survival in The SOD1-G93A Model of Amyotrophic Lateral Sclerosis
Open the record for dataset details and reuse information.
Appendices to the article "Discovery of the preferred direction of EVPA rotations in blazars"
<p>This graphs show the dependence of optical PD and EVPA on time for OJ 287, S5 0716+71, 3C 454.3, CTA 102 and PG 1553+113, respectively, with EVPAs corrected for 180 deg ambiguity (due to large ranges of EVPA changes, the error bars are practically invisible) and all optical EVPA rotations detected in these blazars.</p>
[DATA] The co-evolution of direct, indirect and generalized reciprocity
<p>The data for the project <em>"The Co-evolution of Direct, Indirect, and Generalized Reciprocity"</em> were generated through simulation code that models evolutionary processes. These data can be used to create all the figures in the manuscript.</p> <p>The code for the evolutionary simulations as well as the analysis code are available on GitHub. The repository can be found here: https://github.com/Saptarshi07/Direct-Indirect-Generalized-Reciprocity/.</p> <div> </div>
Table 3 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 3</b> Effect of different plant growth regulators on induction of somatic embryos in three pistachio genotypes' explants (immature zygotic embryos) under light condition.</p><table><tbody><tr><th></th><th>Induction of somatic embryos %</th><th></th><th>Number of embryos/explant</th><th></th></tr></tbody><tbody><tr><th></th><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td></tr><tr><th>E1</th><td>23.22 ± 3.39 c</td><td>22.74 ± 1.46d</td><td>24.67 ± 1.45 c</td><td>4.3 ± 1.2b</td><td>12.33 ± 1.45b</td><td>8 ± 0.58b</td></tr><tr><th>E2</th><td>34.25 ± 0.92b</td><td>34.66 ± 0.22 c</td><td>35.31 ± 0.85b</td><td>12.33 ± 1.45a</td><td>45 ± 2.88 a</td><td>11.33 ± 1.45a</td></tr><tr><th>E6</th><td>43.75 ± 3.6ab</td><td>43.58 ± 0.87b</td><td>42.83 ± 2.80a</td><td>5.33 ± 0.88b</td><td>10 ± 1.15b</td><td>7.67 ± 0.88b</td></tr><tr><th>E11</th><td>50.00 ± 4.12a</td><td>49.95 ± 1.19a</td><td>48.67 ± 2.03a</td><td>4.67 ± 0.88b</td><td>9.33 ± 1.20b</td><td>6 ± 0.58b</td></tr></tbody></table><p>Data within a column followed by different letters indicate significantly differences according to the LSD test at p <.05.</p>
Table 2 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 2</b> PCR primer sequences of selected somatic embryogenesis-related genes for qRT in pistachio.</p><table><tbody><tr><th>Gene name</th><th>Forward primer sequence 5′-3′</th><th>Reverse primer sequence 5′-3′</th><th>Tm (̊C)</th><th>Amplicon length (bp)</th></tr></tbody><tbody><tr><th><i>ACT</i></th><td>GTATCCACGAGACCACCTACA</td><td>GGAGCAACGACCTTGATCTTC</td><td>60</td><td>157</td></tr><tr><th><i>AGL15</i></th><td>GGAGCAATCAAGAGTACAGGAACAG</td><td>CACTTCAGGACTTGCAGAACTATGG</td><td>60</td><td>187</td></tr><tr><th><i>LEC</i></th><td>GATGTGGGGTCTCTTGGAAGGA</td><td>AGCCTGTTTTGCTTTACGAAATCTC</td><td>60</td><td>209</td></tr><tr><th><i>BBM</i></th><td>TCCCAATTAGCAACTACGAGAAAGAG</td><td>CTGATGATGCCTTGTAACACCAC</td><td>60</td><td>140</td></tr><tr><th><i>PKL</i></th><td>GTAGACATCGCACCCTCTTAACTG</td><td>GAGCCAGCATTTTATGAAGTCTTGA</td><td>60</td><td>174</td></tr></tbody></table>
Table 1 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 1</b> Summary of different responses of zygotic immature embryos to different basal medium (BM1 and BM2), combination and concentration of plant growth regulators (PGRs), and light and dark conditions.The response of explants was in the form of callus (C), somatic embryogenesis (SE), and adventitious shoot (AS).The Basal media were BM1: MS mineral salts,B5 vitamins, 30 g L <i>−</i> 1 sucrose, BM2: half strength MS macro salts, B5 vitamins, 100 mg L <i>−</i> 1 L-glutamine, 500 mg L <i>−</i> 1 casein hydrolysate, and 30 g L <i>−</i> 1 sucrose.</p><table><tbody><tr><th>Coding</th><th>PGRs combinations (mg L <i>−</i> 1)</th><th>Light</th><th>Dark</th></tr></tbody><tbody><tr><th></th><td></td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td></tr><tr><th></th><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td></tr><tr><th>E1</th><td>0</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E2</th><td>0.01 IBA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E3</th><td>0.01 IBA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E4</th><td>0.01 IBA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr><tr><th>E5</th><td>0.01 IBA + 3 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E6</th><td>0.01 2,4-D</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E7</th><td>0.01 2,4-D + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E8</th><td>0.01 2,4-D + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E9</th><td>0.01 2,4-D + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E10</th><td>0.01 2,4-D + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E11</th><td>0.01 NAA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E12</th><td>0.01 NAA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E13</th><td>0.01 NAA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E14</th><td>0.01 IBA + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E15</th><td>0.01 IBA + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E16</th><td>0.01 IBA + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E17</th><td>0.01 IBA + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr></tbody></table><p>«–» and « + » represent nonexistence and existence the response on explants that cultured in intended media, respectively.</p>
Data from: Origin of tensile strength of a woven sample cut in bias directions
Textile fabrics are highly anisotropic, so that their mechanical properties including strengths are a function of direction. An extreme case is when a woven fabric sample is cut in such a way where the bias angle and hence the tension loading direction is around 45° relative to the principal directions. Then, once loaded, no yarn in the sample is held at both ends, so the yarns have to build up their internal tension entirely via yarn–yarn friction at the interlacing points. The overall fabric strength in such a sample is a result of contributions from the yarns being pulled out and those broken during the process, and thus becomes a function of the bias direction angle θ, sample width W and length L, along with other factors known to affect fabric strength tested in principal directions. Furthermore, in such a bias sample when the major parameters, e.g. the sample width W, change, not only the resultant strengths differ, but also the strength generating mechanisms (or failure types) vary. This is an interesting problem and is analysed in this study. More specifically, the issues examined in this paper include the exact mechanisms and details of how each interlacing point imparts the frictional constraint for a yarn to acquire tension to the level of its strength when both yarn ends were not actively held by the testing grips; the theoretical expression of the critical yarn length for a yarn to be able to break rather than be pulled out, as a function of the related factors; and the general relations between the tensile strength of such a bias sample and its structural properties. At the end, theoretical predictions are compared with our experimental data.
Data from: Quantifying direct vs. indirect effects of nectar robbers on male and female components of plant fitness
1. Plants interact simultaneously with both mutualists and antagonists. While webs of plant-animal interactions in natural systems can be highly complex, most interactions can be simplified into those that are either direct (mediated through pairwise interactions) or indirect (mediated through third-party species). Mechanistic studies of the direct and indirect pathways by which foliar herbivores affect plants have been well explored; however, mechanistic explorations of how floral herbivores, such as nectar robbers, affect total plant fitness via direct vs. indirect pathways have received less attention. 2. The goal of this study was to assess the importance of direct vs. pollinator-mediated indirect effects of a floral antagonist on female and male components of plant fitness. We focused on the hummingbird-pollinated plant scarlet gilia, Ipomopsis aggregata, which is nectar-robbed by the bumble bee Bombus occidentalis. Prior studies have found evidence for pollinator-mediated indirect effects of robbing on female and male components of I. aggregata fitness, but the mechanisms by which these indirect effects occur, and experimental evidence supporting or refuting direct effects of robbing, have been lacking. 3. We found no evidence for direct effects of robbing on plant fitness. Robbers did not act as pollinators of I. aggregata nor did they directly affect seed production by making nectar-robber holes or removing nectar in hand-pollinated flowers. Moreover, robbing had no direct effect on pollen production per flower or the ability of pollen from robbed flowers to sire seeds in hand-pollinations. 4. However, nectar robbing had indirect effects on plant reproduction mediated through per-visit pollinator effectiveness at depositing pollen in robbed vs. unrobbed flowers. A simple model of a plant-robber-pollinator system suggested that robbing effects in general may occur through more indirect mechanisms when nectar removal by robbers is high relative to nectar replenishment, and that compensation for robbing is then more profitable through the production of additional flowers. 5. Synthesis. Our results highlight the importance of indirect effects in mediating the fitness consequences of species interactions.
Data from: Direct effects dominate responses to climate perturbations in grassland plant communities
Theory predicts that strong indirect effects of environmental change will impact communities when niche differences between competitors are small and variation in the direct effects experienced by competitors is large, but empirical tests are lacking. Here we estimate negative frequency dependence, a proxy for niche differences, and quantify the direct and indirect effects of climate change on each species. Consistent with theory, in four of five communities indirect effects are strongest for species showing weak negative frequency dependence. Indirect effects are also stronger in communities where there is greater variation in direct effects. Overall responses to climate perturbations are driven primarily by direct effects, suggesting that single species models may be adequate for forecasting the impacts of climate change in these communities.
Data from: Direct and indirect effects of pine silviculture on the larval occupancy and breeding of declining amphibian species
1. Plantation silviculture is increasing globally and is particularly intensive in temperate coniferous forests, where densely planting trees requires practices common to non-conifer systems that can alter forest floor microhabitat, and potentially threaten amphibian persistence. Most declining amphibian species depend on specific forest microhabitats as terrestrial refugia, but amphibian extirpation associated with tree harvest alone appears unlikely, suggesting that impacts of planting forests on groundcover might better predict recent declines in amphibian occupancy. 2. We repeatedly sampled larval presence or absence of 10 amphibian species native to temperate coniferous forest in the Southeastern United States for one year at 62 isolated wetlands located in either naturally regenerating or planted forest (plantation) to assess three direct ways that planted forests might reduce amphibian breeding site occupancy by: 1) increasing conifer densities, 2) decreasing groundcover, and 3) an indirect pathway, whereby increased tree densities at plantations might reduce groundcover and thus amphibian site occupancy. 3. After controlling for wetland traits and accounting for differences in detection, breeding site occupancy for 8/10 amphibian species was dependent upon whether forests were planted surrounding wetlands (within 300 m). Herbaceous groundcover, not canopy, most commonly influenced occupancy and increased occupancy for declining surface active or fossorial amphibians. 4. Path analyses showed that, by directly and indirectly reducing groundcover (via conifer densities), plantations had significantly lower occupancy of two declining surface active or fossorial frog species, whereas two common aquatic frog species were tolerant to planting conifers. Among declining species, salamanders showed a greater reduction in occupancy than anurans, likely because of greater vulnerability to the drier forest floor conditions of plantation than naturally regenerating forests. 5. Synthesis and applications: Direct negative impacts of coniferous plantation on amphibians can be addressed by limiting groundcover and soil impacts, including switching from high intensity practices, such as mechanical chopping vegetation or bedding soil, to lower intensity site preparation treatments that are less likely to significantly disturb groundcover. Indirect negative effects of dense canopy cover at planted forests could be lowered by periodically thinning canopies prior to final harvest, thus increasing intact forest groundcover and the conservation of both common and declining amphibians.
Data from: Grazers affect selection on inflorescence height both directly and indirectly and effects change over time
Selection mediated by one biotic agent will often be modified by the presence of other biotic interactions, and the importance of such indirect effects might change over time. We conducted an 11-year field experiment to test the prediction that large grazers affect selection on floral display of the dimorphic herb Primula farinosa not only directly through differential grazing damage, but also indirectly by affecting vegetation height and thereby selection mediated by pollinators and seed predators. Exclusion of large grazers increased vegetation height and the strength of pollinator-mediated selection for tall inflorescences and seed predator-mediated selection for short inflorescences. The direct effect of grazers on selection resulting from differential grazing damage to the two scape morphs showed no temporal trend. By contrast, the increase in vegetation height in exclosures over time was associated with an increase in selection mediated by pollinators and seed predators. In the early years of the experiment, the indirect effects of grazers on selection mediated by pollinators and seed predators were weak, whereas at the end of the experiment, the indirect effects were of similar magnitude as the direct effect due to differential grazing damage. The results demonstrate that the indirect effects of a selective agent can be as strong as its direct effects, and that the relative importance of direct vs. indirect effects on selection can change over time. A full understanding of the ecological processes governing variation in selection thus requires that both direct and indirect effects of biotic interactions are assessed.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.