Find research datasets worth reusing

Supporting Information: Mapping conduits in two-dimensional heterogeneous karst aquifers using hydraulic tomography

This file contains the supplementary data for a article submitted to Journal of Hydrology.

GNSS and Digisonde sporadic-E maps produced by Air Force Institute of Technology

Spatial maps of sporadic-E are produced by combining COSMIC-2 RO data with Digisonde measurements, using the S4-based approach described by Carmona et al. (2022). Images from the TEC-based approach used in other studies are also included for reference.    Carmona, R. A., Nava, O. A., Dao, E. V., & Emmons, D. J. (2022). A Comparison of Sporadic-E Occurrence Rates Using GPS Radio Occultation and Ionosonde Measurements. Remote Sensing, 14(3), 581.

Mapping Phyllosilicates on the Asteroid Bennu Using Thermal Emission Spectra and Machine Learning Model Applications Datasets

We provide laboratory spectra of pure minerals and mineral mixtures and the corresponding metadata. Derived from the laboratory data, we include the PLS model through coefficients. Through the application of the model, we provide the prediction values in volume% for Mg-rich serpentine, cronstedtite, and saponite for the BBD1, EQ3, and TAG datasets.

Mapping Phyllosilicates on the Asteroid Bennu Using Thermal Emission Spectra and Machine Learning Model Applications

We provide the laboratory spectra and metadata that was used to construct the PLS model coefficients. Through the application of the model, we provide the prediction values in volume% for Mg-rich serpentine, cronstedtite, and saponite for the BBD1, EQ3, and TAG datasets.

HYBRIDA Super Map (WP6)

This is the Super Map presented in its original form as a tabular data set. It has been produced by Work Package 6 for the HYBRIDA Project ("Embedding a comprehensive ethical dimension to organoid-based research and resulting technologies") as part of Deliverable 6.1: "Systematic and Structured Gap Analysis".  The Super Map is based on an integration of the mapping of organoid activities produced by WP2 (Task 2.1/D2.1) and the mapping of regulatory frameworks produced by WP3 (Tasks 3.2/3.3/D3.1/D3.2). It shows how and in what ways organoid procurement, derivation, research, and medical application activities are regulated both internationally and by the European Union/European Commission. The Super Map should be read in conjunction with D6.1: "Systematic and Structured Gap Analysis". The HYBRIDA project has been funded with support from the European Commission (Project No: 2018-1-IT02-KA201-048047; Grant Agreement No: 101006012).

Test data for RonaQC - mapped SARS-CoV-2 reads

This dataset includes test data for <a href="https://ronaqc.netlify.app/">RonaQC</a> RonaQC accepts mapped SARS-CoV-2 reads (BAM format), generated from the SARS-CoV-2 bioinformatic pipelines like ARTIC, and any control samples from the respective sequencing run (negative/positive) as input. It will then assess the levels of cross contamination and primer contamination in the samples, and determine if the samples are reliable for detecting SARS-CoV-2, phylogenetic analysis, and/or submission to public databases. The dataset includes SARS-CoV-2 sequenced reads compiled by <a href="https://github.com/CDCgov/datasets-sars-cov-2">CDCgov/datasets-sars-cov-2</a> [1].  These were reads were processed using the <a href="https://github.com/connor-lab/ncov2019-artic-nf">ncov2019-artic-nf pipelines</a>, which is a Nextflow pipeline for running the <a href="https://github.com/artic-network/fieldbioinformatics">ARTIC network's fieldbioinformatics tools</a>, with a focus on ncov2019.  This dataset includes:  <ul> <li>FailedQC - A cohort of 24 samples failed basic QC metrics, covering 8 possible failure scenarios, Illumina platform, amplicon-based approach    </li> <li>VOCRepresentatives - A cohort of 16 samples from 10 representative CDC defined VOI/VOC lineages as of 06/15/2021, Illumina platform, amplicon-based approach    </li> <li>Test - Smaller test samples, including sequenced negative controls of varying quality</li> </ul> [1]  Timme, Ruth E., et al. "Benchmark datasets for phylogenomic pipeline validation, applications for foodborne pathogen surveillance." PeerJ 5 (2017): e3893.

openncgl-uk-2.0Aug 2022View details →

Psychoanalysis on Dictatorially Controlled Media and Mapping of Its Psychopathology in the Impacted Domains

The summarization chart data is a product of media psychology induction in the Communist regime of PRC. Through the industrial sources and production chains, the generation of semantic chains in the Porter Five Force model was analyzed. With a psychoanalyst ego in a propaganda structure of "cultural" products, the process of chain somatic psychology induction to the dictatorial mindset distribution in the "cultural" products psychoanalysis of the socialism suppression and "superstructure" egocentrism's impact in the global realm was mapped in the data created. These have been summarized from my 10 human years of observation in the cinematic industry of the dictatorial regime with my cosmological consciousness. Since many products have been translated to English in the controlled market structures, and language should have been a primary extension of individual emotions and thought products, the monetization of the products through the value chain shaped a unique judicialization-nuclear-semantic-threat pattern of spatial distribution through "power interdependence" theory. The data is a map on the Chinese communist dictatorial psychopathology.

opencc-zeroAug 2022View details →

Quantitative trait loci mapping in cichlid fishes: Aulonocara koningsi x Metriaclima mbenjii and Labidochromis caeruleus x Labeotropheus trewavasae

Since the time of Darwin, biologists have sought to understand the evolution and origins of phenotypic variation. To understand the genetic and molecular sources of morphological differences, we capitalize on the cichlid fish system. Cichlids of the East African Rift Lakes have undergone an extensive adaptive radiation, including variation in body shape, head shape, and pigmentation. These morphological differences are often intimately linked to the ecology and behavior of these animals. Here, we investigate the genetic basis of these phenotypes using quantitative trait loci (QTL) mapping using four genera of Lake Malawi cichlids and two F2 hybrid populations. The first hybrid cross is between Aulonocara koningsi, which lives in the open sandy region and feeds insects from the open sand, and Metriaclima mbenjii, an omnivore rock-dwelling fish. The second cross is between Labidochromis caeruleus, a suction-feeding insectivore that swims continuously searching for prey, and Labeotropheus trewavasae, which feeds by biting or scraping attached algae from the rocks in its benthic habitat. Such work can provide insights into the molecular basis of phenotypic adaptation, the genetic architecture of morphology, and the evolution of cichlid fishes.

Vertical velocity maps for the Nice Côte d'Azur airport measured by InSAR

The present datasets consists in three InSAR velocity maps in mm/yr (vertical land velocity) that shows the ongoing Nice Côte d'Azur airport subsidence from 1992 until today. The three velocity maps have been computed from SAR data acquired by three succesive ESA missions (ERS, Envisat, and Sentinel-1).

China 2017-2021 rapeseed map

China rapeseed maps for 2017-2021 were the 20-meter resolution rapeseed classification product generated by RSG-OC algorithms. The product is divided into 52 regular 5°*6° tiles (Figure 1). Each tile is named by “N”+6° Zone Number. +"_"+ the initial latitude+ "_"+ the year of the map + “RapeseedMap”+the resolution+”.tif”, where 6°Zone Number is the value of the 6° zone where the tile is located and Initial latitude is the latitude value of the lower edge line of the tile.

E. coli-ΦX174 genotype to phenotype map reveals flexibility and diversity in LPS structures

Here are the raw sequencing data of all E. coli C and ΦX174 strains obtained during this study. A short description of each file's content can be found below.   Bacteria <ul> <li>"E.coliC_res.zip": Whole genome sequencing results of E. coli C WT and ΦX174-resistant strains (generated by fluctuation experiments). All E. coli C samples were prepared for whole-genome sequencing from one millilitre of stationary-phase cultures. Genomic DNA was extracted using the Wizard® Genomic DNA purification Kit (Promega, Germany). Bacterial samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany) using an Illumina Nextera DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</li> </ul>   <ul> <li>"E.coliC_res_excluded.zip": Whole genome sequencing results of the four ΦX174-resistant E. coli C strains (generated by fluctuation experiments) that have been excluded from the analyses: E. coli C R1, R3, R15, and R19. We found that both E. coli C R3 and R15 were not isogenic. While whole-genome sequencing from their respective glycerol stocks showed only a single mutation in galE, whole-genome sequencing carried on colony re-streaks showed that additional mutations were systematically associated with the single mutation in galE (see file "E.coliC_res_excluded_10_clones). E. coli C R1 displayed an unstable resistant phenotype. Finally, E. coli C R19 was partially resistant to ΦX174 WT. It carries a single mutation in the yajC gene, which encodes for a periplasmic protein. No apparent link to the LPS biosynthesis or assembly has been discovered yet, but yajC might play a role in phage DNA injection into the bacterium’s cytoplasmic membrane.</li> </ul>   <ul> <li>"E.coliC_res_excluded_10_clones.zip": Whole genome sequencing results of 10 randomly chosen isolates of E. coli C R1, R3, and R15.</li> </ul>   <ul> <li>"EcoliC.gb": E. coli C WT strain used as reference.</li> </ul>   Bacteriophages   <ul> <li>“PhiX174_PCR_399r_400f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul>   PhiX174_399_r: CTTGACTCATGATTTCTTACC PhiX174_400_f: TTACTGAACAATCCGTACGTTTC   DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads.   <ul> <li>“PhiX174_PCR_2361r_2362f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul>   PhiX174_2361_r: TCGCTTGGTCAACCCCTCAG PhiX174_2362_f: AGCGCGGTAGGTTTTCTGCT   DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads. <ul> <li>“PhiX174_excluded.zip”: Since we removed R19 from the final analysis, we also removed its corresponding evolved phage obtained during the first evolution experiment (ΦX174 R19 T1). We also removed the phage infecting R5 (ΦX174 R5 T2) because it was not isogenic (confirmed by Sanger Sequencing).</li> </ul> <ul> <li>“PhiX174_Sequencing_Sanger.zip”: Both F and H genes were amplified by performing 35 cycles of PCR using Phusion® High-Fidelity PCR Master Mix with HF Buffer. The sequencing primers are listed in the Information_Sanger_Samples_ID.xlsx file.</li> </ul>   <ul> <li>“PhiX174_ref.gb”: PhiX174 WT strain used as reference.</li> </ul>   We also include the raw data and pictures from our spotting tests and plaque assays used to complete the final matrix of infection. <ul> <li>Spotting_tests_reanalyzed.xlsx”: Raw data from the pictures (see Photos_matrices.zip) used to generate the Hierarchical agglomerative clustering analysis of the host ranges of evolved phage and Infection matrix of evolved ΦX174 phages on the 31 resistant E. coli C strains.</li> </ul> The Photos_matrices.zip folder contains   <ul> <li>“SSA_matrix_Bact_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted phages on bacterial lawns.</li> </ul>   <ul> <li>“SSA_matrix_Phi_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted bacteria on phage lawns.</li> </ul>   <ul> <li>“Mismatches”: We performed plaque assays when combinations of phages and bacteria showed discrepancies between the two spotting test methods</li> </ul>   <ul> <li>“Plaque_assays_R12_R14”: pictures of plaque assays where we tested the sensitivity of E. coli C R12 and R14 toward a subset of evolved phages</li> </ul>   <ul> <li>“Plaque_assays_of_PhiX174R22T1c1/R28T1c1_vs_WT”: pictures of plaque assays where we tested the sensitivity of E. coli C WT toward phages infecting R22 and R28.</li> </ul>   <ul> <li>“displayImage.R”. Script made to look for the desired combination of phage and bacterium.</li> </ul>   Finally, we include the raw OD measurments:   <ul> <li>“All_EcoliC_growth_raw_data.xlsx”: raw OD measurements of each E. coli C resistant strains used in this study.</li> </ul>

opencc-zeroDec 2021View details →

Jumping out of trouble: Evidence for a cognitive map in guppies (Poecilia reticulata)

Spatial cognitive abilities allow individuals to remember the location of resources such as food patches, predator hide-outs, or shelters. Animals typically incorporate learnt spatial information or use external environmental cues to navigate their surroundings. A spectacular example of how some fishes move is through aerial jumping. For instance, fish that are trapped within isolated pools, cut off from the main body of water during dry periods, may jump over obstacles and direct their jumps to return to safe locations. However, what information such as re-orientation behaviour during jumping is based on remains enigmatic. Here we combine a lab and field experiment to test if guppies (Poecilia reticulata) incorporate learnt spatial information and external environmental cues (visual and auditory) to determine where to jump. In a spatial memory assay we found that guppies were more likely to jump towards deeper areas, hence incorporating past spatial information to jump to safety. In a matched vs. mismatched spatial cue experiment in the field, we found that animals only showed directed jumping when visual and auditory cues matched. We show that in unfamiliar entrapments guppies direct their jumps by combining visual and auditory cues, while in familiar entrapments they use a cognitive map. We hence conclude that jumping behaviour is a goal-directed behaviour, guided by different sources of information and involving important spatial cognitive skills.

opencc-zeroAug 2022View details →

Data for: Mapping the ecological resilience of Atlantic postglacial heaths

Anthropogenic heathlands are semi-cultural ecosystems with a unique cultural and biodiversity value, considered worthy of preservation across most of the world. Their rate of loss, however, is alarming. Currently, we know little about the heathlands' actual span of instability and their association with abiotic and anthropogenic factors, including how much additional intervention they need to persist. Consequently, we are missing out on vital knowledge for conservation, management, and the historical persistence of heathlands. This paper develops a method to assess the ecological resilience of Atlantic inland heaths in the absence of human management. We use 12 existing cases of heathland succession to establish a four-step resilience grade for each site, which we regress onto a series of explaining factors and use in predicting postglacial heath resilience across Atlantic Northern Europe. We find that temperature, humidity, elevation and sandiness have a positive correlation with high heathland resilience. Our predictive mapping shows an uneven distribution of ecological heath resilience across Atlantic Northern Europe within an area of 1000x1200 km of 5x5 km resolution. Compared with archaeological and palaeoecological evidence, prehistoric heathland distributions far exceed areas that afford high heath resilience, suggesting that heath distribution and persistence depends on both abiotic and anthropogenic factors. Policy implications: The predictive map can be used as an initial screening tool for managers working towards heath preservation and restoration to predict resilience, prioritize conservation, and to plan management practices across Atlantic Northern Europe. The developed model and predictive map provide an important initial screening tool to assess heathland resilience for ecologists and will help managers to prioritize conservation efforts of heathland ecosystems. The results are equally relevant for scholars who are interested in humans' role in increasing and decreasing ecosystem resilience. Moreover, we speculate that our predictive method can be applied in other regions across the world by adding regionally-specific variables.

opencc-zeroSep 2022View details →

Data for: Improving routine childhood immunisation outcomes in low- and middle-income countries: An evidence gap map

Objective: To support evidence-informed decision-making, we created an evidence gap map (EGM) to characterise the evidence base on the effectiveness of interventions in improving routine childhood immunisation outcomes in low- and middle-income countries (LMICs). Methods: We developed an intervention-outcome matrix with 38 interventions and 43 outcomes. We searched academic databases and grey literature sources for relevant impact evaluations (IEs) and systematic reviews (SRs). Search results were screened on title/abstract. Those included in the title/abstract were retrieved for a full review. Studies meeting the eligibility criteria were included and data were extracted for each included study. All screening and data extraction was done by two independent reviewers. We analysed these data to identify trends in the geographic distribution of evidence, the concentration of evidence across intervention and outcome categories, and attention to vulnerable populations in the literature. Results: We identified 309 studies, comprising 226 completed IEs, 58 completed SRs, 24 ongoing IEs, and 1 ongoing SR. Evidence from IEs is heavily concentrated in a handful of countries in Sub- Saharan Africa and South Asia. Among interventions, the most frequently evaluated are those related to education and material incentives for caregivers or health workers. There are gaps in the study of non-material incentives and outreach to vulnerable populations. Among outcomes, those related to vaccine coverage and health are well covered. However, evidence on intermediate outcomes related to health system capacity or barriers faced by caregivers is much more limited. Conclusions: There is valuable evidence available to decision-makers for use in identifying and deploying effective strategies to increase routine immunisation in LMICs. However, additional research is needed to address gaps in the evidence base.

Manually mapped traces from UAV-acquired images of Loviisa shoreline outcrops

This dataset contains manually mapped two-dimensional bedrock fracture traces from shoreline outcrop orthomosaics generated from UAV-acquired images (https://doi.org/10.5281/zenodo.7077518). The outcrops are located along the shoreline of Loviisa, South-East Finland. Mapping has been done in ArcGIS with snapping toggled on to document the topological abutment relationships between traces. Data is published as ESRI Shapefiles in the ETRS-TM35FIN (EPSG:3067) coordinate system.  The work in manual mapping was done as part of a Geological Survey of Finland project, KYT KARIKKO, with funding from Finnish National Nuclear Waste Management Fund (KYT) during the years 2019 and 2020. This dataset has been previously used as part of a Master's Thesis, which can be located here: <a href="https://urn.fi/URN:NBN:fi-fe202003259211">https://urn.fi/URN:NBN:fi-fe202003259211</a>, and in a Journal of Structural Geology article (OG1 target area), located here: https://doi.org/10.1016/j.jsg.2021.104304.

Automatically mapped traces from UAV-acquired images of Loviisa shoreline outcrops

This dataset contains automatically mapped two-dimensional bedrock fracture traces from shoreline outcrop orthomosaics generated from UAV-acquired images (https://doi.org/10.5281/zenodo.7077518). The outcrops are located along the shoreline of Loviisa, South-East Finland. Code for automatic mapping is available on GitHub (https://github.com/nialov/ALSA). Data is published as ESRI Shapefiles in the ETRS-TM35FIN (EPSG:3067) coordinate system.  The work in automatic mapping was done as part of a Geological Survey of Finland project, Kallioperän Rikkonaisuus, during 2021-2022.

Machine Learning the Hohenberg-Kohn Map to Molecular Excited States

The dataset and code used in paper”Machine Learning the Hohenberg-Kohn Map to Molecular Excited States” For detailed information of each file, see Readme.txt

opencc-by-4.0Feb 2021View details →

European forest disturbance map

Description This repository holds maps of annual forest disturbances across 35 European countries derived from Landsat satellite data. The disturbance maps currently cover the time period 1986-2020 and are accompanied by a map of disturbance severity (for the moment only until 2016) and a forest mask. The methodological details are explained in Senf and Seidl 2021 (see reference blow). The maps are available per country as geoTIFF. The spatial reference system is EPSG 3035 (ETRS89 / LAEA Europe). The most current version is 1.1.2. The maps will be updated regularly. <a href="https://corneliussenf.users.earthengine.app/view/european-disturbance-map">The maps can also be explored online</a>. Citation Please cite the dataset including version number and following paper when using the maps: Senf, C. and Seidl, R. (2021) Mapping the forest disturbance regimes of Europe. Nature Sustainability. <a href="https://www.nature.com/articles/s41893-020-00609-y">https://www.nature.com/articles/s41893-020-00609-y</a> Version history <ul> <li>1.0.0 - Initial version, covering 2016-1986 and including a forest mask and an estimate of disturbance severity.</li> <li>1.1.0 - Map update until 2020 using same methods as in version 1.0.0. Not accompanied by disturbance severity.</li> <li>1.1.1 - Added disturbance maps for Andorra, Liechtenstein and Luxembourg.</li> <li>1.1.2 - Added disturbance severity to version.</li> <li>1.1.3 - Improved file structure for easier download.</li> <li>1.1.4 - Fixed wrong/missing forest masks.</li> </ul> Known issues <ul> <li>Some SLC-off artefacts visible in northern Serbia (both version 1.0.0 and 1.1.0).</li> <li>Known false disturbances mapped in Norway in 2020 in version 1.1.0.</li> <li>Missing disturbances from 1986 in Andorra and Liechtenstein. (version 1.1.1).</li> </ul>

opencc-by-4.0Jun 2009View details →

Mapping FRSAD model and other abstract models

Recording of the presentation based on the work of the IFLA FRSAR Working Group IFLA FRBR Group 3 entities "represent an additional set of entities that serve as the subjects of works" (IFLA, 1999: 16). A third IFLA Working Group of the FRBR family, FRSAR (Functional Requirements for Subject Authority Records), was formed in April 2005 and charged with the task of developing functional requirements and a conceptual model for subject authority records. One of the terms of reference is to build a conceptual model of Group 3 entities within the FRBR framework as they relate to the “aboutness” of works. In this framework all three entity groups as defined by the FRBR conceptual model have the potential to be the subject of a work. In other words, Group 1, 2 and 3 entities all can have an “is-subject-of” relationship with a work. The FRSAR Working Group proposed an abstract conceptual model and presented it at the IFLA Conference in August 2007. The model was further discussed and developed by the Working Group in 2008. The draft report prepared by the FRSAR Working Group has indicated that the focus of the model is on the authority data instead of authority records, hence the abbreviation used in the report is FRSAD, i.e., Functional Requirements for Subject Authority Data.

Taxon Name Mapping for Nomer

Taxon Name Mapping for Nomer generated from GBIF/iDiBio interaction records.