Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
54,099
datasets available to search
ShareScore release 0.9.0
Dataset results
54,099 results for “Expression”
The Effect of Different Ways for Expressing Negation
Open the record for dataset details and reuse information.
Data files for the manuscript Valvular expression of factor XI correlates with valve calcification and aortic stenosis severity
Open the record for dataset details and reuse information.
Transcriptomic evidence for Brachyury expression in the caudal tip region of adult Ptychodera flava (Hemichordata)
<p>Most metazoans have a single-copy of the T-box transcription factor gene,<em> Brachyury</em>. The gene is expressed in cells of the blastopore of late blastulae and the archenteron invagination and stomodeum invagination regions of gastrulae. It appears to be crucial for gastrulation and mesoderm differentiation of embryos. Although this expression pattern is shared by most deuterostomes<a href="#_msocom_1">[AA1]</a> , <em>Brachyury</em> expression was not reported in adult stage. Here we show that <em>Brachyury</em> of an indirect-developer, a hemichordate acorn-worm, <em>Ptychodera flava,</em> is expressed not only in embryonic cells but also in cells of the caudal tip (anus) region of adults. This spatially restricted expression shown by whole-mount <em>in situ</em> hybridization was confirmed by Iso-seq RNA sequencing analyses and single cell RNA-seq (scRNA-seq) analysis. Iso-seq analysis showed that the gene expression occurred only in the caudal region of the adult but not in the anterior regions including stomochord. scRNA-seq analysis showed that a cluster that contained <em>Brachyury</em>-expressing cells composed of mesoderm-related cells, but not associated with epidermis, nervous system, and muscle. Although further studies are required to examine roles of <em>Brachyury</em> at the adult stage, this study suggests a possible evolutionary link of the <em>Brachyury</em>-expressing caudal tip of hemichordates with the anus formation region of chordates.</p>
HOW ARTICLES ENHANCE THE EXPRESSIVENESS OF SENTENCES.
Open the record for dataset details and reuse information.
Figure S1: The expression of mapped genes across various tissues.
Open the record for dataset details and reuse information.
Supplemental Figure 1- Violin plots illustrating average expression of sox2, her6, isl1, prop1, and fcer1gl
Open the record for dataset details and reuse information.
Endothelial progenitor cells-derived exosomal miRNA-31 can alleviate septic peritonitis by inhibiting E-selectin expression
Open the record for dataset details and reuse information.
CYP3A4 and NF-KB gene expression in carbamazepine-induced hepatotoxicity ameliorated by pentoxifylline in rats
Open the record for dataset details and reuse information.
Gene Expression Transcriptomics Data for benchmarking Perturbation Models - Part 3
Open the record for dataset details and reuse information.
Tracing vs. Semantics: On the Different Levels of Understanding Boolean Expressions
Open the record for dataset details and reuse information.
Table 3 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 3</b> Effect of different plant growth regulators on induction of somatic embryos in three pistachio genotypes' explants (immature zygotic embryos) under light condition.</p><table><tbody><tr><th></th><th>Induction of somatic embryos %</th><th></th><th>Number of embryos/explant</th><th></th></tr></tbody><tbody><tr><th></th><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td></tr><tr><th>E1</th><td>23.22 ± 3.39 c</td><td>22.74 ± 1.46d</td><td>24.67 ± 1.45 c</td><td>4.3 ± 1.2b</td><td>12.33 ± 1.45b</td><td>8 ± 0.58b</td></tr><tr><th>E2</th><td>34.25 ± 0.92b</td><td>34.66 ± 0.22 c</td><td>35.31 ± 0.85b</td><td>12.33 ± 1.45a</td><td>45 ± 2.88 a</td><td>11.33 ± 1.45a</td></tr><tr><th>E6</th><td>43.75 ± 3.6ab</td><td>43.58 ± 0.87b</td><td>42.83 ± 2.80a</td><td>5.33 ± 0.88b</td><td>10 ± 1.15b</td><td>7.67 ± 0.88b</td></tr><tr><th>E11</th><td>50.00 ± 4.12a</td><td>49.95 ± 1.19a</td><td>48.67 ± 2.03a</td><td>4.67 ± 0.88b</td><td>9.33 ± 1.20b</td><td>6 ± 0.58b</td></tr></tbody></table><p>Data within a column followed by different letters indicate significantly differences according to the LSD test at p <.05.</p>
Table 2 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 2</b> PCR primer sequences of selected somatic embryogenesis-related genes for qRT in pistachio.</p><table><tbody><tr><th>Gene name</th><th>Forward primer sequence 5′-3′</th><th>Reverse primer sequence 5′-3′</th><th>Tm (̊C)</th><th>Amplicon length (bp)</th></tr></tbody><tbody><tr><th><i>ACT</i></th><td>GTATCCACGAGACCACCTACA</td><td>GGAGCAACGACCTTGATCTTC</td><td>60</td><td>157</td></tr><tr><th><i>AGL15</i></th><td>GGAGCAATCAAGAGTACAGGAACAG</td><td>CACTTCAGGACTTGCAGAACTATGG</td><td>60</td><td>187</td></tr><tr><th><i>LEC</i></th><td>GATGTGGGGTCTCTTGGAAGGA</td><td>AGCCTGTTTTGCTTTACGAAATCTC</td><td>60</td><td>209</td></tr><tr><th><i>BBM</i></th><td>TCCCAATTAGCAACTACGAGAAAGAG</td><td>CTGATGATGCCTTGTAACACCAC</td><td>60</td><td>140</td></tr><tr><th><i>PKL</i></th><td>GTAGACATCGCACCCTCTTAACTG</td><td>GAGCCAGCATTTTATGAAGTCTTGA</td><td>60</td><td>174</td></tr></tbody></table>
Table 1 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes
<p><b>Table 1</b> Summary of different responses of zygotic immature embryos to different basal medium (BM1 and BM2), combination and concentration of plant growth regulators (PGRs), and light and dark conditions.The response of explants was in the form of callus (C), somatic embryogenesis (SE), and adventitious shoot (AS).The Basal media were BM1: MS mineral salts,B5 vitamins, 30 g L <i>−</i> 1 sucrose, BM2: half strength MS macro salts, B5 vitamins, 100 mg L <i>−</i> 1 L-glutamine, 500 mg L <i>−</i> 1 casein hydrolysate, and 30 g L <i>−</i> 1 sucrose.</p><table><tbody><tr><th>Coding</th><th>PGRs combinations (mg L <i>−</i> 1)</th><th>Light</th><th>Dark</th></tr></tbody><tbody><tr><th></th><td></td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td></tr><tr><th></th><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td></tr><tr><th>E1</th><td>0</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E2</th><td>0.01 IBA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E3</th><td>0.01 IBA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E4</th><td>0.01 IBA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr><tr><th>E5</th><td>0.01 IBA + 3 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E6</th><td>0.01 2,4-D</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E7</th><td>0.01 2,4-D + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E8</th><td>0.01 2,4-D + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E9</th><td>0.01 2,4-D + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E10</th><td>0.01 2,4-D + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E11</th><td>0.01 NAA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E12</th><td>0.01 NAA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E13</th><td>0.01 NAA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E14</th><td>0.01 IBA + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E15</th><td>0.01 IBA + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E16</th><td>0.01 IBA + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E17</th><td>0.01 IBA + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr></tbody></table><p>«–» and « + » represent nonexistence and existence the response on explants that cultured in intended media, respectively.</p>
Data from: Gene expression patterns associated with caste and reproductive status in ants: worker-specific genes are more derived than queen-specific ones
Variation in gene expression leads to phenotypic diversity and plays a central role in caste differentiation of eusocial insect species. In social Hymenoptera, females with the same genetic background can develop into queens or workers, which are characterized by divergent morphologies, behaviors and lifespan. Moreover, many social insects exhibit behaviorally distinct worker castes, such as brood-tenders and foragers. Researchers have just started to explore which genes are differentially expressed to achieve this remarkable phenotypic plasticity. Although the queen is normally the only reproductive individual in the nest, following her removal, young brood-tending workers often develop ovaries and start to reproduce. Here, we make use of this ability in the ant Temnothorax longispinosus and compare gene expression patterns in the queens and three worker castes along a reproductive gradient. We found the largest expression differences between the queen and the worker castes (~2,500 genes), and the smallest differences between infertile brood-tenders and foragers (~300 genes). The expression profile of fertile workers is more worker-like, but to a certain extent intermediate between the queen and the infertile worker castes. In contrast to the queen, a high number of differentially expressed genes in the worker castes are of unknown function, pointing to the derived status of Hymenopteran workers within insects.
Data from: Calcisponges have a ParaHox gene and dynamic expression of dispersed NK homeobox genes
Sponges are simple animals with few cell types, but their genomes paradoxically contain a wide variety of developmental transcription factors1, 2, 3, 4, including homeobox genes belonging to the Antennapedia (ANTP) class5, 6, which in bilaterians encompass Hox, ParaHox and NK genes. In the genome of the demosponge Amphimedon queenslandica, no Hox or ParaHox genes are present, but NK genes are linked in a tight cluster similar to the NK clusters of bilaterians5. It has been proposed that Hox and ParaHox genes originated from NK cluster genes after divergence of sponges from the lineage leading to cnidarians and bilaterians5, 7. On the other hand, synteny analysis lends support to the notion that the absence of Hox and ParaHox genes in Amphimedon is a result of secondary loss (the ghost locus hypothesis)8. Here we analysed complete suites of ANTP-class homeoboxes in two calcareous sponges, Sycon ciliatum and Leucosolenia complicata. Our phylogenetic analyses demonstrate that these calcisponges possess orthologues of bilaterian NK genes (Hex, Hmx and Msx), a varying number of additional NK genes and one ParaHox gene, Cdx. Despite the generation of scaffolds spanning multiple genes, we find no evidence of clustering of Sycon NK genes. All Sycon ANTP-class genes are developmentally expressed, with patterns suggesting their involvement in cell type specification in embryos and adults, metamorphosis and body plan patterning. These results demonstrate that ParaHox genes predate the origin of sponges, thus confirming the ghost locus hypothesis8, and highlight the need to analyse the genomes of multiple sponge lineages to obtain a complete picture of the ancestral composition of the first animal genome.
Data from: Challenges and strategies in transcriptome assembly and differential gene expression quantification. A comprehensive in silico assessment of RNA-seq experiments.
Transcriptome Shotgun Sequencing (RNA-seq) has been readily embraced by geneticists and molecular ecologists alike. As with all high-throughput technologies, it is critical to understand which analytic strategies are best suited and which parameters may bias the interpretation of the data. Here we use a comprehensive simulation approach to explore how various features of the transcriptome (complexity, degree of polymorphism π, alternative splicing), technological processing (sequencing error ε, library normalization) and bioinformatic workflow (de novo vs. mapping assembly, reference genome quality) impact transcriptome quality and inference of differential gene expression (DE). We find that transcriptome assembly and gene expression profiling (edgeR vs. baySeq software) works well even in the absence of a reference genome, and is robust across a broad range of parameters. We advise against library normalization, and in most situations advocate mapping assemblies to an annotated genome of a divergent sister clade, which generally outperformed de novo assembly (Trans-Abyss, Trinity, SOAPdenovo-Trans). Transcriptome complexity (size, paralogs, alternative splicing isoforms) negatively affected the assembly and DE profiling, whereas the effects of sequencing error and polymorphism were almost negligible. Finally, we highlight the challenge of gene name assignment for de novo assemblies, the importance of mapping strategies, and raise awareness of challenges associated with the quality of reference genomes. Overall, our results have significant practical and methodological implications, and can provide guidance in the design and analysis of RNA-seq experiments, particularly for organisms where genomic background information is lacking.
Data from: A whole-transcriptome approach to evaluating reference genes for quantitative gene expression studies: a case study in Mimulus
While quantitative PCR (qPCR) is widely recognized as being among the most accurate methods for quantifying gene expression, it is highly dependent on the use of reliable, stably expressed reference genes. With the increased availability of high-throughput methods for measuring gene expression, whole-transcriptome approaches may be increasingly utilized for reference gene selection and validation. In this study, RNA-seq was used to identify a set of novel qPCR reference genes and evaluate a panel of traditional "housekeeping" reference genes in two species of the evolutionary model plant genus Mimulus. More broadly, the methods proposed in this study can be used to harness the power of transcriptomes to identify appropriate reference genes for qPCR in any study organism, including emerging and nonmodel systems. We find that RNA-seq accurately estimates gene expression means in comparison to qPCR, and that expression means are robust to moderate environmental and genetic variation. However, measures of expression variability were only in agreement with qPCR for samples obtained from a shared environment. This result, along with transcriptome-wide comparisons, suggests that environmental changes have greater impacts on expression variability than on expression means. We discuss how this issue can be addressed through experimental design, and suggest that the ever-expanding pool of published transcriptomes represents a rich and low-cost resource for developing better reference genes for qPCR.
Data from: Near absence of differential gene expression in the retina of rainbow trout after exposure to a magnetic pulse: implications for magnetoreception
The ability to perceive Earth's magnetic field, or magnetoreception, exists in numerous animals. Although the mechanism underlying magnetoreception has not been clearly established in any species, in salmonid fish it is hypothesized to occur by means of crystals of magnetite associated with nervous tissue such as the brain, olfactory organ, or retina. In this study, rainbow trout (Oncorhynchus mykiss) were exposed to a brief magnetic pulse known to disrupt magnetic orientation behavior in several animals. Changes in gene expression induced by the pulse were then examined in the retina. Analyses indicated that the pulse elicited differential expression of only a single gene, gamma-crystallin M3-like (crygm3). The near-absence of an effect of the magnetic pulse on gene expression in the retina stands in sharp contrast to a recent study in which 181 genes were differentially expressed in brain tissue of O. mykiss after exposure to the same pulse. Overall, our results suggest either that magnetite-based magnetoreceptors in trout are not located in the retina, or else that they are unaffected by magnetic pulses that can disrupt magnetic orientation behavior in animals.
Data from: Gene expression under thermal stress varies across a geographic range expansion front
Many ectothermic species are currently expanding their distributions polewards due to anthropogenic global warming. Molecular genetic mechanisms facilitating range expansion under these conditions are largely unknown, but understanding these could help mitigate expanding pests and disease vectors, or help explain why some species fail to track changing climates. Here, using RNA-seq data, we examine genome-wide changes in gene expression under heat and cold stress in the range-expanding damselfly Ischnura elegans in northern Europe. We find that both the number of genes involved and levels of gene expression under heat stress have become attenuated during the expansion, consistent with a previously-reported release from selection on heat tolerances as species move polewards. Genes upregulated under cold stress differed between core and edge populations, corroborating previously-reported rapid adaptation to cooler climates at the expansion front. Expression of sixty-nine genes exhibited a region x treatment effect; these were primarily upregulated in response to heat stress in core populations but in response to cold stress at the range edge, suggesting that some cellular responses originally adapted to heat stress may switch to cold stress functionality upon encountering novel thermal selection regimes during range expansion. Transcriptional responses to thermal stress involving heat shock and neural function genes were largely geographically conserved, while retrotransposon, regulatory, muscle function and defence gene expression patterns were more variable. Flexible mechanisms of cold stress response and the ability of some genes to shift their function between heat and cold stress might be key mechanisms facilitating rapid poleward expansion in insects.
Data from: Masculinisation of gene expression is associated with male quality in Drosophila melanogaster
The signature of sexual selection has been revealed through the study of differences in patterns of genome-wide gene expression, both between the sexes and between alternative reproductive morphs within a single sex. What remains unclear, however, is whether differences in gene expression patterns between individuals of a given sex consistently map to variation in individual quality. Such a pattern, particularly if found in males, would provide unambiguous evidence that the phenotypic response to sexual selection is shaped through sex-specific alterations to the transcriptome. To redress this knowledge gap, we explored whether patterns of sex-biased gene expression are associated with variation in male reproductive quality in Drosophila melanogaster. We measured two male reproductive phenotypes, and their association with sex-biased gene expression, across a selection of inbred lines from the Drosophila Genetic Reference Panel. Genotypes with higher expression of male-biased genes produced males exhibiting shorter latencies to copulation, and higher capacity to inseminate females. Conversely, female-biased genes tended to show negative associations with these male reproductive traits across genotypes. We uncovered similar patterns, by reanalysing a published dataset from a second D. melanogaster population. Our results reveal the footprint of sexual selection in masculinising the male transcriptome.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.