Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

3,663

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

3,663 results for “Phylogenetic analysis”

Learn how ShareScore rates datasets ↗
zenodo40/100

Linked collectors and determiners for: Phylogenetic analysis of the Belostoma plebejum group sensu Nieser (Insecta, Hemiptera, Belostomatidae): the effect of adding continuous characters on its accuracy.

Natural history specimen data linked to collectors and determiners held within, "Phylogenetic analysis of the Belostoma plebejum group sensu Nieser (Insecta, Hemiptera, Belostomatidae): the effect of adding continuous characters on its accuracy". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/0367aa61-0794-47f5-84b8-8abde5050c40">https://bionomia.net/dataset/0367aa61-0794-47f5-84b8-8abde5050c40</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/0367aa61-0794-47f5-84b8-8abde5050c40">https://gbif.org/dataset/0367aa61-0794-47f5-84b8-8abde5050c40</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Systematic revision and morphological phylogenetic analysis of Anchylorhynchus Schoenherr, 1836 (Coleoptera, Curculionidae: Derelomini).

Natural history specimen data linked to collectors and determiners held within, "Systematic revision and morphological phylogenetic analysis of Anchylorhynchus Schoenherr, 1836 (Coleoptera, Curculionidae: Derelomini)". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/878bffa3-3f56-4b12-954a-981aeb0ac246">https://bionomia.net/dataset/878bffa3-3f56-4b12-954a-981aeb0ac246</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/878bffa3-3f56-4b12-954a-981aeb0ac246">https://gbif.org/dataset/878bffa3-3f56-4b12-954a-981aeb0ac246</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Simulation data for "Phylogenetic analysis of migration, differentiation, and class switching in B cells"

<p>Simulation data for https://doi.org/10.1101/2020.05.30.124446.</p> <p>Scripts available at: https://bitbucket.org/kleinstein/projects/src/master/Hoehn2020/</p> <p>data_twostate.tsv: AIRR TSV file of data used for simulations</p> <p>trees_twostate.RData: Tree topologies used to simulate migration</p> <p>simulations.tar.gz: Files used in simulation analyses. File names show:</p> <p>&lt;rate (r)&gt;_&lt;rate A to B (r_ab)&gt;_&lt;pi_A&gt;_&lt;repetition&gt;</p> <p>laddersims.tar.gz: Files used in ladder tree simulation analyses. File names show:</p> <p>&lt;rate (r)&gt;_&lt;rate A to B (r_ab)&gt;_&lt;pi_A&gt;_&lt;number of tips&gt;_&lt;number of trees&gt;_&lt;repetition&gt;</p> <p>&nbsp;</p>

opencc-by-4.0Aug 2021View details →
zenodo40/100

Figure 22 in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 22. Niphargus polymorphus sp. n., holotype. Pereopods III–IV, detail of pereopod IV dactylus. Retinacle of pleopod II. Uropods I–III. Telson.

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 18 in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 18. Niphargus lourensis sp. n., holotype. Pereopods III–IV, detail of pereopod IV dactylus. Uropods I–III. Telson.

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 14 in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 14. Niphargus dabarensis sp. n., holotype. Pereopods III–IV, detail of pereopod IV dactylus. Uropods I–III. Telson.

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 3 in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 3. Distribution of characters ''antenna I-length'' (character 19, CI50.18, RI50.53; left) and ''gnathopod II article 6 size'' (character 39, CI50.33, RI50.7; right). Long antennae are considered as troglomorphic, whereas a large-sized gnathopod II is supposed to be a synapomorphy of ''Orniphargus'' (S. Karaman (1950c)).

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 10. N in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 10. N. dolichopus sp. n., holotype. Pereopods III–IV, detail of pereopod IV dactylus. Retinacle of pleopod II. Uropods I–III. Telson.

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 2 in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 2. Distribution of characters ''body shape'' (character 2, CI51, RI51; left) and ''body size'' (character 1, CI50.28, RI50.37; right). Note that the body shape is plesiomorphic in most of the ''Orniphargus'' taxa, and large body size is a highly convergent (possibly troglomorphic) character.

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 1. A in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 1. A strict consensus tree of 34 most parsimonious trees (length5472; CI50.26, RI50.60). Values of Bremer support index (decay index) are indicated below branches. Taxa traditionally assigned to the ''Orniphargus'' species aggregate, as well as clades for which character analysis was performed, are encircled in boxes. Note 1: Despite of its position on the cladogram N. pectinicauda has never been considered as an ''Orniphargus'' taxon. Note 2: Taxa are named according to their lowest rank. For full names, see Tables I and II.

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 5 in Phylogenetic analysis of the Niphargus orcinus species- aggregate (Crustacea: Amphipoda: Niphargidae) with description of new taxa

Figure 5. Distribution of characters ''type of setae/spines along postero-dorsal margin of pleonites'' (character 14, CI50.2, RI50.5; left) and ''uropod I rami-spines'' (character 58, CI50.37, RI50.73; right). Both characters are supposed to be characteristics of ''Orniphargus'' (S. Karaman (1950c)).

opencc-by-4.0Dec 2006View details →
zenodo40/100

Figure 6 in On a new species and genus in the Cypridini (Crustacea, Ostracoda, Cyprididae) from South Africa, with a phylogenetic analysis of the tribe and a discussion on the genus concept in this group

Figure 6. Phylogenetic analyses of matrix given in Appendix 1. Trees are phylograms computed by NJ method, but for all three situations at least some of the equally parsimonious MP phylograms (as computed by branch-andbound routine) had an identical topology. Values without brackets represent distance bootstraps (10,000 replicates) using NJ, values in brackets are MP bootstrap values (10,000 replicates) using full heuristic method. (A) Weight of all characters (1–17)51; (B) weight of valve characters (1–9)55, of soft part characters (10–17)51; (C) weight of all soft part characters (10–17)55, of valves characters (1–9)51.

opencc-by-4.0Mar 2007View details →
zenodo40/100

Figure 5. Mnementh brennei n. gen. n in On a new species and genus in the Cypridini (Crustacea, Ostracoda, Cyprididae) from South Africa, with a phylogenetic analysis of the tribe and a discussion on the genus concept in this group

Figure 5. Mnementh brennei n. gen. n. sp., male, Western Cape, South Africa. (A) T3 (OC.2917); (B) T2 (OC.2915); (C) attachment of caudal ramus (OC.2915); (D) caudal ramus (OC.2915). Scale: 20× (A, B); 10× (C, D).

opencc-by-4.0Mar 2007View details →
zenodo40/100

Figure 2. Mnementh brennei n. gen. n in On a new species and genus in the Cypridini (Crustacea, Ostracoda, Cyprididae) from South Africa, with a phylogenetic analysis of the tribe and a discussion on the genus concept in this group

Figure 2. Mnementh brennei n. gen. n. sp., Western Cape, South Africa. (A) Female, LV, internal view (OC.2922); (B) female, RV, internal view (OC.2922); (C) male, LV, internal view (OC.2915); (D) male, RV, internal view (OC.2915); (E) male, carapace, right lateral view (OC.2921); (F) female, carapace left lateral view (OC.2919); (G) female, RV, internal view, detail of anterior part (OC.2922); (H) female, LV, internal view, detail of anterior part (OC.2922); (I) male, RV, internal view, detail of anterior part (OC.2915); (J) female, RV, internal view, detail of posterior part (OC.2922); (K) female, carapace, ventral view, detail of anterior part (specimen lost); (L) male, carapace, right lateral view, detail of anterior part (OC.2921); (M) female, carapace, ventral view (specimen lost); (N) male, carapace, dorsal view (OC.2920). Scale bar: 2170 mm (A–F, M, N); 926 mm (G–L).

opencc-by-4.0Mar 2007View details →
zenodo40/100

Figure 1 in On a new species and genus in the Cypridini (Crustacea, Ostracoda, Cyprididae) from South Africa, with a phylogenetic analysis of the tribe and a discussion on the genus concept in this group

Figure 1. Map showing localities of Mnementh brennei n. gen. n. sp. in the Western Cape Province of South Africa.

opencc-by-4.0Mar 2007View details →
zenodo40/100

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle &amp; Wickham, 2013). Image source: Google Maps.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

opencc-by-4.0Sep 2017View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record