Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,696
datasets available to search
ShareScore release 0.9.0
Dataset results
3,696 results for “Reference”
Text-fig. 2. Kaolin clay pit at hill Hasenberg in Wiesa, Saxony, Germany; view of southern high wall, showing deeply weathered late Early Miocene lignite seam by dark brown color in center (photographed 2015). Fossil-bearing strata were reported (e.g., Mai 1964) as below lignite seam, but this horizon does actually not crop out (also evidenced by new drillings, communicated by Dr. Jochen Rascher, GEOMONTAN GmbH company, Freiberg/Sa., Germany). in Assessment Of Phytogeographic Reference Regions For Cenozoic Vegetation: A Case Study On The Miocene Flora Of Wiesa (Germany)
Text-fig. 2. Kaolin clay pit at hill Hasenberg in Wiesa, Saxony, Germany; view of southern high wall, showing deeply weathered late Early Miocene lignite seam by dark brown color in center (photographed 2015). Fossil-bearing strata were reported (e.g., Mai 1964) as below lignite seam, but this horizon does actually not crop out (also evidenced by new drillings, communicated by Dr. Jochen Rascher, GEOMONTAN GmbH company, Freiberg/Sa., Germany).
Text-fig. 1. Location of Wiesa fossil site in eastern Germany and other fossil sites for comparison. Explanation for map b: all fossil sites – black circles; grey circles – cities; topographic names in italics – German states (Länder). For bio- and lithostratigraphic data of fossil sites, see chapter Methodologies and material and Text-fig. 3. in Assessment Of Phytogeographic Reference Regions For Cenozoic Vegetation: A Case Study On The Miocene Flora Of Wiesa (Germany)
Text-fig. 1. Location of Wiesa fossil site in eastern Germany and other fossil sites for comparison. Explanation for map b: all fossil sites – black circles; grey circles – cities; topographic names in italics – German states (Länder). For bio- and lithostratigraphic data of fossil sites, see chapter Methodologies and material and Text-fig. 3.
Figure 3 in Butterfly-parasitoid-hostplant interactions in Western Palaearctic Hesperiidae: a DNA barcoding reference library
Figure 3. Mounted specimens illustrating the species of Microgastrinae recovered in this study. A, Cotesia glabrata Telenga ex Carcharodus alceae, Italy. Adult plus cocoons. Gregarious parasitoid; brood sizes vary considerably, host usually well grown or prepupal when killed. The other Cotesia species (near glabrata) look similar and behave in the same way. B, Dolichogenidea sp. near sicaria Marshall, ex Carcharodus alceae, Spain. Adult plus cocoon. Solitary parasitoid, killing the host while still quite young. C, Microgaster australis Thomson, ex Muschampia stauderi, Greece. Adult plus cocoon. Solitary parasitoid, usually killing the host as a prepupa. D, Microgaster nobilis Reinhard, ex Carcharodus alceae, Spain. Adult plus cocoon. Solitary parasitoid, usually killing the host as a prepupa. All specimens are in the collection of the National Museums of Scotland.
Figure 4 in Butterfly-parasitoid-hostplant interactions in Western Palaearctic Hesperiidae: a DNA barcoding reference library
Figure 4. Interaction matrices showing the recorded interactions of Hesperiidae and their hostplants (A), Hesperiidae and their parasitoids (B) and parasitoids and hostplants of Hesperiidae (C). White squares indicate recorded interactions between the taxa in the corresponding row and column, while blue squares indicate lack of interaction.
Figure 2 in Butterfly-parasitoid-hostplant interactions in Western Palaearctic Hesperiidae: a DNA barcoding reference library
Figure 2. Circular cladogram showing ecological interactions among European and North African Hesperiidae, their hostplants, and their microgastrine parasitoids, recovered through DNA barcoding for Hesperiidae and/or parasitoids. Hesperiid, parasitoid and plant cladograms are coloured in orange, blue and green, respectively. Lines representing interactions with parasitoids are coloured in blue, while lines involving hostplant interactions are coloured in green.
Figure 1 in Butterfly-parasitoid-hostplant interactions in Western Palaearctic Hesperiidae: a DNA barcoding reference library
Figure 1. Representation of the study system. Hesperiid larvae feeding on their hostplants can be attacked by a number of parasitoids, which can in turn be attacked by various hyperparasitoids. A, Spialia rosae on its hostplant Rosa sicula. B, third instar larva of Sp. rosae on a silk shelter. C, Microgaster australis parasitizing an L3 Sp. rosae larva. D, Gelis sp. parasitizing M. australis on its cocoon after emerging from the Sp. rosae larva. Drawings by Martí Franch.
Reference atmospheres, surface and instrument data used in the test experiments presented in Ridolfi et al. 2022 (doi.org/10.5194/amt-2022-82)
<p>The supplied archive includes a set of ASCII files defining the reference atmospheric and surface states that are the basis of the simulation experiments presented in the paper of Ridolfi et al. 2022 (doi.org/10.5194/amt-2022-82). Along with atmospheric and surface data, we also supply the seasonal variability and mismatch errors used in the test experiments presented in that paper, the noise error covariance matrices anticipated for FORUM and IASI-NG spectra, and some details of the retrieval setup. The archive includes a README file summarizing the contents of the various files provided.</p>
WWVB Plus 1 kHz Reference Tone
<p>FLAC audio recording of WWVB plus a 1 kHz phase reference tone for propagation analysis during the August 21, 2017 solar eclipse. This recording was made between 14:00 UTC and 22:00 UTC by KD2BD in Wall Township, New Jersey (FN20xd). This is an 8 hour recording, with the effects of the solar eclipse visible between 03:00:00 (17:00 UTC), and approximately 05:30:00 (19:30 UTC).</p> <p>Audio from WWVB was recorded as a 1 kHz tone on the left audio channel. A 1 kHz reference tone was recorded on the right channel. The phase of the reference tone was close to zero degrees at the beginning of the recording.</p> <p> </p>
Reference data used in pufferfish pre-print experiments
<p>This holds the reference data used in the pufferfish pre-print. This includes a specific version of the human transcriptome, the human genome, and a collection of microbial genomes. These references are also available from different public repositories, but these versions are uploaded here to ease reproducibility of the manuscript's tests, and because the references were pre-processed to replace ambiguous nucleotides with valid ones.</p>
Fig. 4 in The Jordan theropod (Maastrichtian, Montana, U.S.A.) referred to the genus Aublysodon
Fig. 4 - Comparison of The skulls of A, Aubtysodon; B, Coelopbysis (AMNB 7224); C, Dromaeosaurus (modified from Coibert & Russell, 1969, Fig. 1); D, Velociraptor (modified from Barsbold, 1982, Fig. la); E, Sauromitboides (modified from Barsbold, 1974, Pl. 1), V, Dromiceiomimus (modified from Russell, 1972, Fig. 5, and ROM 840); G, Caegnatbus (modified from Sternberg, 1949, Fig. 1, and Barsbold, 1982, Fig. c); H, Albeltosaurus libratus (modified from Gilmore, 1946, Pl. 4, Fig. 3); I, Daspletosaurus torosus (modified from Russell, 1970, Fig. 6); J, "Albertosaurus" lancensis (modified from Gilmore, 1946, Pl. 1); H, Tyrannosaurus (modified from Osborn, 1912, Fig. 1); L, lingual (top) and labial (bottom) views of the dentaries of "Cbirostenotes" (modified from Gilmore, 1924, Fig. 3). Scale bar represents 10 cm. Comparaison des cranes des divers théropodes: A, Aubtysodon; B, Coelopbysis (AMNB 7224); C, Dromaeosaurus (modifiés d'après Colbert & Russell 1969, Fig. 1); D, Velociraptor (modifié d'après Barsbold 1982, Fig. la); E, Sauromitboides (modifié d'après Barsbold 1974, Pl. 1); F, Dromiceiomimus (modifié d'après Russell 1972, Fig. 5 et ROM 840); C, Caenagnatbus (modifié d'après Sternberg 1949, Fig. 1 et Barsbold 1982, Fig. c); H, Albertosaurus libratus (modifié d'après Gilmore 1946, PI. 4, Fig. 3); I, Daspletosaurus torosus (modifié d'après Russell 1970, Fig. 6);J, "Albertosaurud' lancensis (modifié d'après Gilmore 1946, Pl. 1); K, Tyrannosaurus (modifié d'après Osborn 1912, Fig. 1); L, les vues linguale (en haut) et labiale (en bas) des dentaires du "Cbirostenotes" (modifié d'après Gilmore 1924, Fig. 3). Echelle = 10 cm.
Fig. 2 in The Jordan theropod (Maastrichtian, Montana, U.S.A.) referred to the genus Aublysodon
Fig. 2 - Cheek teeth of Aubtysodon mirandus. Left sixth maxillary tooth, as preserved, in lateral (A) and posterior (B) aspects. Right fourth dentary tooth, rendered in unworn condition, in anterior (C) and labial (D) aspects. Scale bar represents 10 mm. Les dents jugales de VAubtysodon mirandus. Sixième dent maxiliaire gauche telle qu'elle est conservée en vue laterale (A) et vue postérieure (B). Quatrième dent du dentaire droit, figurées sans usure en vue antérieure (C) et en vue labiale (D). Echelle: 10 mm.
MolSSI Reference Integral Project - Reference Datafiles
<p>These files contain integral data calculated as part of the MolSSI Integral Reference Project (MIRP).</p> <p>As part of MIRP, integrals are computed via arbitrary-precision interval arithmetic. These values are then rounded to the nearest double-precision value, and stored in these data files. The files are compressed with bzip2, and should be uncompressed before use.</p> <p>Currently, only ERI for gaussian-type orbitals are computed. The basis set data is included within the reference files themselves.</p> <p>Software for creating these files (including documentation), and examples of reading from them, can be found at DOI 10.5281/zenodo.1063526</p> <p>More information about the reference project can be found at http://molssi.org and at https://github.com/MolSSI/MIRP</p>
Training data for 'Reference based RADSeq ' tutorial (Galaxy Training Material)
<p>The data provided here are part of a Galaxy Training Network tutorial that analyzes RAD-seq data from a study published by Hohelnlohe et al., 2010 (DOI:10.1371/journal.pgen.1000862) to identify and type single nucleotide polymorphisms (SNPs) in each of 100 individuals from two oceanic and three freshwater populations and thus estimate genetic diversity and differentiation among populations. </p>
Рис. 2. Распредение биомассы Mytilus trossulus septentrionalis на литорали дальневоcточных морей России. Здесь и далее на гистограммах по оси абцисс после географических пунктов в скобках укаЗана выборка (число иЗученных проб), по оси ординат – максимальные ЗначениЯ биомассы вида. Под Значением биомассы 0.1 г/м² подраЗумеваютсЯ качественные пробы. СокраЩениЯ (бмп) и (топ) оЗначают соответственно беринговоморское и тихоокеанское побережьЯ Восточной Камчатки. Побережье Зал. Петра Великого от устьЯ р. Туманной к северу до м. Поворотного условно отноcитсЯ к южному Приморью; побережье к северу от м. Поворотного (пос. Преображение, б. СоколовскаЯ) до б. Ольга, включительно, условно относитсЯ к среднему Приморью; побережье к северу от б. Ольга до м. Белкина и материковое побережье Татарского пролива относим к северному Приморью. Fig. 2. The distribution of biomass of Mytilus trossulus septentrionalis in the intertidal zone of the Far Eastern seas of Russia. Here and throughout on histograms, on the abcissa is the number of studied samples (numbers in parentheses following the names geographic localities), on the ordinate is the maximum biomass of species. The number 0.1 g wet wt m-2 means the qualitative samples. Abbreviations (bmp) and (top) mean the Bering Sea coast and the Pacific coast of eastern Kamchatka. The coast of Peter the Great Bay from the mouth of the Tumannaya River to Cape Povorotny is conditionally referred to as southern Primorye; the area north of Cape Povorotny (Preobrazhenie Settlement, Sokolovskaya Bay) to Olga Bay inclusive is conditionally referred to as middle Primorye; north of Olga Bay to Cape Belkin and the mainland coast of the Tatar Strait to as northern Primorye. in Bivalve mollusks of the intertidal zone of the Far Eastern seas of Russia
Рис. 2. Распредение биомассы Mytilus trossulus septentrionalis на литорали дальневоcточных морей России. Здесь и далее на гистограммах по оси абцисс после географических пунктов в скобках укаЗана выборка (число иЗученных проб), по оси ординат – максимальные ЗначениЯ биомассы вида. Под Значением биомассы 0.1 г/м² подраЗумеваютсЯ качественные пробы. СокраЩениЯ (бмп) и (топ) оЗначают соответственно беринговоморское и тихоокеанское побережьЯ Восточной Камчатки. Побережье Зал. Петра Великого от устьЯ р. Туманной к северу до м. Поворотного условно отноcитсЯ к южному Приморью; побережье к северу от м. Поворотного (пос. Преображение, б. СоколовскаЯ) до б. Ольга, включительно, условно относитсЯ к среднему Приморью; побережье к северу от б. Ольга до м. Белкина и материковое побережье Татарского пролива относим к северному Приморью. Fig. 2. The distribution of biomass of Mytilus trossulus septentrionalis in the intertidal zone of the Far Eastern seas of Russia. Here and throughout on histograms, on the abcissa is the number of studied samples (numbers in parentheses following the names geographic localities), on the ordinate is the maximum biomass of species. The number 0.1 g wet wt m-2 means the qualitative samples. Abbreviations (bmp) and (top) mean the Bering Sea coast and the Pacific coast of eastern Kamchatka. The coast of Peter the Great Bay from the mouth of the Tumannaya River to Cape Povorotny is conditionally referred to as southern Primorye; the area north of Cape Povorotny (Preobrazhenie Settlement, Sokolovskaya Bay) to Olga Bay inclusive is conditionally referred to as middle Primorye; north of Olga Bay to Cape Belkin and the mainland coast of the Tatar Strait to as northern Primorye.
rCRUX Generated MiFish Universal 12S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in January 2024.</p> <p>Primer Name: MiFish Universal<br>Gene: 12S<br>Length of Target: 163–185<br>get_seeds_local() minimum length: 170<br>get_seeds_local() maximum length: 400<br>blast_seeds() minimum length: 140<br>blast_seeds() maximum length: 400<br>max_to_blast: 1000<br>Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br>Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br>Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p> <p>This project was funded by the NOAA 'Omics Program.</p>
STAR Reference Files for GRCm39 and GRCh38
<p>This is a <a href="https://github.com/alexdobin/STAR/tree/master">STAR</a> reference index file that uses a recent version (2.7.11b) of STAR to be compatible with STARsolo. The source of these reference files has been taken from the <a href="https://www.10xgenomics.com/support/software/cell-ranger/downloads#reference-downloads">CellRanger pre-built references </a>of GRCm39 (2024-A) and GRCh38 (2024-A), respectively.</p> <p>Although the CellRanger pre-built references already contain STAR reference files, they are NOT compatible with STARsolo or the latest version of STAR. Those who need newer STAR references can use this repository. </p> <p>This repository is intended to facilitate the use of the NovaScope pipeline, but can also be used as a general purpose reference for STAR and STARsolo.</p>
Public reference library for edible dormouse calls
<p>The acoustics of small mammals, particularly dormice species, are generally understudied. We explored the vocalisations and acoustic behaviour of the edible dormouse (<em>Glis glis</em>) in various environments in Catalonia (northern Iberian Peninsula) using ultrasound recorders between 2022 and 2023. Up to five different types of calls were identified in various environmental conditions (captivity and free-ranging animals) and developmental stages, from pups to adults. Additionally, one new call type was described, highlighting the plasticity of their vocalisations, and ultrasonic sound production was discovered in pups, suggesting ontogenetic changes in the vocal repertoire. With this project, we emphasise the potential of the acoustic method as a non-invasive tool for studying ecological behaviours and interactions, or early detection of the species in the natural environment.</p> <p>We, hereby, provide an open reference library for edible dormouse calls, laying the groundwork for a better understanding of its acoustics, behaviour and conservation. The compilation provides five clean sequences of high quality for each of the five call types recorded under different environmental conditions (totalling 35 recordings). This includes the chirp (captivity and wild), blow (captivity), aggressive call (captivity and wild), pups during manipulation (wild) and free-ranging pups (wild). The collection of sounds was prepared under the Dormouse Project (<a href="http://www.dormice.org/" target="_blank" rel="noopener">www.dormice.org</a>)</p> <p>This work was supported by the Barcelona Zoo Fundation under the Research and Conservation Program Grant; Generalitat de Catalunya under Grant number ARD264/23/000001; and Diputació de Barcelona under Grant number 2023/0005732.</p>
Reference data set used to validate the hybrid cropland map at 500m (Fritz, S. 2024)
<p>This is a reference data set for validation of the hybrid cropland map at 500m resolution for the year 2019 (Fritz, 2024, map <a title="Hybrid cropland map (GLAD/WorldCereal)" href="../doi/10.5281/zenodo.10818823" target="_blank" rel="noopener">available here</a>)</p> <p>Sampling design: random whithin areas of improvement, where the WorldCereal map is performing better (less errors) than the GLAD cropland map 2019. </p> <p>Number of sample sites: 500</p> <p>Method of data collection: visual interpreation of various sources of information, including very high resolution images and photos. </p> <p><br>Tool for data collection: <a href="https://www.geo-wiki.org" target="_blank" rel="noopener">Geo-Wiki</a></p>
Fig. 1 in Status and importance of research on marine sponges in India with special reference to sponges on coral reefs
Fig. 1 — Sponges overgrowing corals in different reef areas in India: a) Terpios hoshinota invading a coral colony in Poovarasanpatti Island of Gulf of Mannar; b) An unknown sponge species invading a coral colony in Bangaram Island of Lakshadweep; and c) Cliona sp. invading a coral colony in Rock Garden area in Malvan coast, Maharashtra
Fig. 2. A, male Nyctixalus margaritifer. B–C in A reference collection of the acoustic signals of male Nyctixalus margaritifer Boulenger, 1882 (Anura: Rhacophoridae)
Fig. 2. A, male Nyctixalus margaritifer. B–C, general structure of notes within a note group. B, one of the basic/fundamental note types. C, one of the longer notes.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.