Find research datasets worth reusing

Data set on the impact of selected plant protection products on ecosystem service providers, including interactive effects

The Excel files contain the results of ecotoxicological tests for the effects of selected insecticides on ESP species. The objective of this dataset is to provide original data from acute and semi-chronic laboratory tests on a few important beneficial species with broad geographic distribution. The data allow the evaluation of delayed effects and possible interactive effects of combined treatments for those pesticides that are commonly used in mixtures or sprayed next to each other in short time intervals, effectively exposing non-target arthropods to combined/sequential effects. Each data file contains the “Description” sheet where all details of the test and the exact meaning of data fields in the database are reported. The data files are named in a self-explanatory manner, starting with the name of the institution that produced the data (UC – University of Coimbra; UJA – Jagiellonian University), followed by the name of the tested species and names of tested products.

opencc-by-4.0Mar 2023View details →

Pre-Aksumite Plant Husbandry in the Horn of Africa - Datasets

This repository contains the results datasets of the article Pre-Aksumite Plant Husbandry in the Horn of Africa published by the journal Vegetation History and Archaeobotany.

Global Planting Suitability of Wheat Under the 1.5 °C and 2 °C Warming Goals

Global Planting Suitability of Wheat Under the 1.5 °C and 2 °C Warming Goals Authors: Xi Guo; Puying Zhang; Yaojie Yue This is the outcome data of our research which is under submission. Though the impact of climate change on potential crop distributions has been extensively explored, there are few studies on potential wheat distributions at specific global warming levels (GWLs), e.g., 1.5 °C and 2 °C. Here, a grided (0.5 degree × 0.5 degree) dataset of global potential wheat distribution under the 1.5 °C and 2 °C GWLs is proposed.  This dataset is produced using the MaxEnt model with support of multi-model data(GFDL-ESM2M, HadGEM2-ES, IPSL-CM5A-LR, MIROC-ESM-CHEM, and NorESM1-M). The predictive accuracy of the proposed dataset was carefully validated between the predicted global wheat distribution and multiple known datasets.   For more details of the approach used to predict the global wheat distribution please refer to: Yue, Y., Zhang, P., Shang, Y., 2019.  The potential global distribution and dynamics of wheat under multiple climate change scenarios. Sci Total Environ 688, 1308-1318.  https://coi.org/10.1016/j.scitotenv.2019.06.153. The results indicate the regional differences in the potential suitability of wheat cultivation under different GWLs.  Eastern Europe, Pakistan, Northern India, Russia, and Canada witnessed a significant increase in wheat planting suitability.  In contrast, Central Eastern Africa, Southeastern Australia, Southeastern China, Southern Brazil, France, Spain, and Italy demonstrated a significant decrease in wheat suitability.  Compared with 1.5 °C GWLs, wheat planting suitability decreases more evidently in 2 °C GWLs in Central and Eastern Africa, Central and Southern India, Southeastern China, Australia, Mexico, Southern Brazil, and Argentina. Simultaneously, regions such as Russia, Pakistan, Canada, and the Great Lakes area of the United States observed further increases in wheat planting suitability.  To ensure favorable conditions for the cultivation of wheat, it is crucial to limit the global average temperature increase to less than 2 °C. Our findings demonstrate the influence of different GWLs on potential global wheat distribution, highlighting the regional differences in the potential suitability of wheat cultivation under different GWLs. We argue that the potential global wheat distribution datasets under different GWLs are a valuable complement to currently available products. This potential global wheat distribution is one of the few products to take into account 1.5 °C and 2 °C GWLs based on multi-modal data. We believe that it can provide more valuable information for policymakers to make decisions for the warming world. The data of the Global Planting Suitability of Wheat Under the 1.5 °C and 2 °C Warming Goals is stored in a zip package, that is Global Planting Suitability of Wheat.zip. This package consists of 1 folder, i.e., SR1.5&2.0. This subfolder contains GeoTIFF files for the Global Planting Suitability of Wheat Under the 1.5 °C and 2 °C Warming Goals. Correspondingly Wheat_SR15.tif and Wheat_SR20.tif. The grid value of each file ranges from 0 to 1, indicating the possibility of wheat planting in each grid, and the higher the value, the higher the possibility that wheat exists. Reference: Yue, Y., Zhang, P., Shang, Y., 2019.  The potential global distribution and dynamics of wheat under multiple climate change scenarios. Sci Total Environ 688, 1308-1318.  https://coi.org/10.1016/j.scitotenv.2019.06.153.

opencc-zeroSep 2023View details →

Data from: Urbanization alters the spatiotemporal dynamics of plant-pollinator networks in a tropical megacity

Urbanization is a major driver of biodiversity change but how it interacts with spatial and temporal gradients to influence the dynamics of plant-pollinator networks is poorly understood, especially in tropical urbanization hotspots. Here, we analyzed the drivers of environmental, spatial, and temporal turnover of plant-pollinator interactions (interaction β-diversity) along an urbanization gradient in Bengaluru, a South Indian megacity. The compositional turnover of plant-pollinator interactions differed more between seasons and with local urbanization intensity than with spatial distance, suggesting that seasonality and environmental filtering were more important than dispersal limitation for explaining plant-pollinator interaction β-diversity. Furthermore, urbanization amplified the seasonal dynamics of plant-pollinator interactions, with stronger temporal turnover in urban compared to rural sites, driven by greater turnover of native non-crop plant species (not managed by people). Our study demonstrates that environmental, spatial, and temporal gradients interact to shape the dynamics of plant-pollinator networks and urbanization can strongly amplify these dynamics.

Fig. 12 in The Australian issid planthopper genus Orinda Kirkaldy, 1907: New subgenera, new species, host plant and identification key (Hemiptera: Fulgoromorpha: Issidae)

Fig. 12. Habitat of Orinda (Scapulorinda) scapularis (Jacobi, 1928), Lake Eacham car park, 6 May 2022.

Fig. 10 in The Australian issid planthopper genus Orinda Kirkaldy, 1907: New subgenera, new species, host plant and identification key (Hemiptera: Fulgoromorpha: Issidae)

Fig. 10. Habitat and host plant of Orinda (Montorinda) montana sp. nov., Mount Walsh National Park, 14 Dec. 2019. A. Mount Walsh as seen from the car park. B. Landscape on the top of Mount Walsh with shrubs growing between the rocks. C. Host plant, Grevillea whiteana Mc Gill. (Proteaceae). D–E. Host plant, G. whiteana, detail.

Fig. 9 in The Australian issid planthopper genus Orinda Kirkaldy, 1907: New subgenera, new species, host plant and identification key (Hemiptera: Fulgoromorpha: Issidae)

Fig. 9. Orinda (Montorinda) montana sp. nov., Ô, holotype (QM), terminalia. A–D. Pygofer, anal tube and gonostyli. A. Left lateral view. B. Left posterolateral view. C. Posterior view. D. Dorsal view. E–L. Aedeagus. E. Left lateral view. F. Posterior view. G. Left laterodorsal view. H. Left lateroventral view. I. Dorsal view. J. Anterodorsal view. K. Aedeagus posteroventral view. L. Ventral view. Abbreviations: see Material and methods.

Fig. 8 in The Australian issid planthopper genus Orinda Kirkaldy, 1907: New subgenera, new species, host plant and identification key (Hemiptera: Fulgoromorpha: Issidae)

Fig. 8. Orinda (Montorinda) montana sp. nov., ♀, paratype (QM). A. Habitus, dorsal view. B. Habitus, ventral view. C. Habitus, lateral view. D. Posterior wing. E. Habitus, anterolateral view. F. Habitus, perpendicular view of frons. G. Left posterior leg, apical half of tibia and tarsus, ventral view.

Fig. 1 in The Australian issid planthopper genus Orinda Kirkaldy, 1907: New subgenera, new species, host plant and identification key (Hemiptera: Fulgoromorpha: Issidae)

Fig. 1. Orinda (Montorinda) eungellana sp. nov., Ô, holotype (QM). A. Habitus, dorsal view. B. Habitus, ventral view. C. Habitus, lateral view. D. Posterior wing. E. Habitus, anterolateral view. F. Habitus, perpendicular view of frons. G. Left posterior leg, apical half of tibia and tarsus, ventral view.

Fig. 4 in The Australian issid planthopper genus Orinda Kirkaldy, 1907: New subgenera, new species, host plant and identification key (Hemiptera: Fulgoromorpha: Issidae)

Fig. 4. Orinda (Montorinda) spp., adeagus of holotypes. A–B. O. (Montorinda) eungellana sp. nov. A. Left lateral view. B. Posterior view. C–D. O. (Montorinda) montana sp. nov. C. Left lateral view. D. Posterior view.

Fig. 3 in The Australian issid planthopper genus Orinda Kirkaldy, 1907: New subgenera, new species, host plant and identification key (Hemiptera: Fulgoromorpha: Issidae)

Fig. 3. Orinda (Montorinda) eungellana sp. nov., Ô, holotype (QM), terminalia. A–D. Pygofer, anal tube and gonostyli. A. Left lateral view. B. Left posterolateral view. C. Posterior view. D. Dorsal view. E–L. Aedeagus. E. Left lateral view. F. Posterior view. G. Left laterodorsal view. H. Left lateroventral view. I. Dorsal view. J. Anterodorsal view. K. Posteroventral view. L. Ventral view. Abbreviations: see Material and methods.

opencc-by-nc-4.0Sep 2023View details →

Verzehrsstudie zur Ermittlung der Lebensmittelaufnahme von Säuglingen und Kleinkindern für die Abschätzung eines akuten Toxizitätsrisikos durch Rückstände von Pflanzenschutzmitteln (VELS) [Consumption study to determine the food intake of infants and young children for the estimation of an acute toxicity risk through residues of plant protection products]

The VELS study (Verzehrsstudie zur Ermittlung der Lebensmittelaufnahme von Säuglingen und Kleinkindern für die Abschätzung eines akuten Toxizitätsrisikos durch Rückstände von Pflanzenschutzmitteln; VELS) was conducted in 2001/2002. Data were collected from 804 infants, toddlers and children (age group 0.5 to <5 years) in Germany. The food consumed was recorded by the parents as "food as eaten" over a total of 6 days (2x3-day food record with an interval of 3-6 months for toddlers and 4-8 weeks for infants). Anthropometric data are also included. Foods are coded according to the German food coding system (BLS; Bundeslebensmittelschlüssel) and food names and additional information is available in German only. Dataset owner: German Federal Institute for Risk Assessment (BfR) Data collection was carried out by the University of Paderborn on behalf of the Federal Ministry of Food and Agriculture [Bundesministerium für Ernährung und Landwirtschaft; BMEL] – formerly Federal Ministry for Food, Agriculture and Consumer Protection [Bundesministerium für Verbraucherschutz, Ernährung und Landwirtschaft; BMVEL]

openother-openOct 2023View details →

R code and datasets for flower-visitor interactions (pollinators, robbers, thieves) and plant traits from Mount Cameroon

Raw data and R code for: Cheaters among pollinators: Nectar robbing and thieving vary spatiotemporally with floral traits in Afrotropical forests. Ecosphere, 2023. doi: 10.1002/ecs2.4696  When using the dataset for anything, cite the Sakhalkar et al. Ecosphere paper. All related information can be found in the cited paper. For additional information, refer to the paper or write to either robert.tropek@gmail.com or sailee.sakha@gmail.com.

opencc-by-4.0May 2023View details →

rCRUX Generated ITS2 Plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  ITS2 Plants Gene:   ITS2 Length of Target:    450-550 get_seeds_local() minimum length:    315 get_seeds_local() maximum length:    600 blast_seeds() minimum length:    270 blast_seeds() maximum length:    560 max_to_blast:  100 Forward Sequence (5'-3'):   ATGCGATACTTGGTGTGAAT Reverse Sequence (5'-3'):    GACGCTTCTCCAGACTACAAT Reference:    Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... & Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. <a href="https://doi.org/10.1371/journal.pone.0067818">https://doi.org/10.1371/journal.pone.0067818</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

opencc-by-4.0May 2023View details →

rCRUX Generated trnl plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  trnl plants Gene:   trnl Length of Target:    ~85 get_seeds_local() minimum length:    60 get_seeds_local() maximum length:    110 blast_seeds() minimum length:    23 blast_seeds() maximum length:    73 max_to_blast:  250 Forward Sequence (5'-3'):   GGGCAATCCTGAGCCAA Reverse Sequence (5'-3'):    TTTGAGTCTCTGCACCTATC Reference:   Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... & Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007). https://doi.org/10.1093%2Fnar%2Fgkl938 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

opencc-by-4.0Aug 2021View details →

Figure 1 in First report of Aethalion reticulatum (Linnaeus, 1767) (Hemiptera: Aethalionidae) infesting plants of Coffea arabica (Linnaeus, 1753) (Rubiaceae)

Figure 1: Aethalion reticulatum (Linnaeus, 1767) (Hemiptera: Aethalionidae) and Coffea arabica (Linnaeus, 1753) (Rubiaceae). (A) Coffee crop cultivation Mundo Novo 379-19, (B) Inflorescence of C. arabica, (C and D) colony of A. reticulatum in the C. arabica plant and Camponotus spp. ants.

opencc-zeroOct 2023View details →

Metabolizable energy and biomass of plants consumed by caribou (Rangifer tarandus) in tundra communities of northern Alaska and deer (Odocoileus spp.) in forests and grasslands of Washington, United States of America

A ubiquitous interaction operates at the base of food webs in many terrestrial ecosystems of the world, creating the foundation for bottom-up regulation of consumers. This interaction plays out as follows. Populations of herbivores deplete plant biomass by foraging. Increasing herbivore population size intensifies this depletion, which in turn, creates a negative feedback regulating herbivore population growth. Large herbivores and the plants they consume offer a useful system for studying this interaction because populations of large herbivores are often regulated by density dependence, defined as the reduction in the per-capita growth rate that occurs as populations grow. Diminished body mass of individuals has been repeatedly observed in high-density populations, implicating plant-mediated, diminished nutrition as the primary cause of density dependence. However, there is no general explanation for why these nutritional deficiencies occur. The data deposited here were used to demonstrate fit new model of the feedbacks from plant biomass to herbivores. The model shows how reduced nutrition of herbivores can result from increased dilution of metabolizable energy in the plant tissue they consume as populations grow even when a large fraction of the consumable plant biomass remains uneaten. This result provides a tidy, mechanistic explanation for bottom-up control of population dynamics of primary consumers in a "green world."

opencc-zeroOct 2023View details →

Naturalization of introduced plants is driven by life-form-dependent cultivation biases

Aims: Most naturalized plants are escapees from cultivation. Inventories of cultivated introduced species thus offer unique, still underutilized, opportunities to assess naturalization drivers of introduced plants. We used a comprehensive inventory of 13,718 introduced species cultivated in China's botanical gardens to test which species characteristics distinguish the 739 species that have naturalized. Locations: China. Methods: We used generalized linear models to test whether the naturalization of cultivated introduced plants in China is associated with functional traits, propagule pressure, environmental niche, and introduction history. To test direct and indirect effects of those variables and their relative importance in driving naturalization, we used structural equation models. Results: We showed that species were more likely to naturalize when they originate from the Americas, are more widely cultivated, and have a longer residence time. Moreover, species were more likely to naturalize if they have a good environmental match, are short-lived herbs, are predominantly propagated from seeds, and, in the case of herbs, are relatively tall compared to other herbs. Part of the latter effects are mediated by how these variables relate to propagule-pressure proxies, and this varies among short-lived herbs, long-lived herbs and woody plants. Main conclusions: Naturalization is partly driven by life-form-dependent cultivation biases.

opencc-by-4.0Oct 2023View details →

Plant Cassandra retrotransposons: LTR alignment data and Astereaceae full length annotation

Supplemental material to the article:  "Evolving together: Cassandra retrotransposons gradually mirror promoter mutations of the 5S rRNA genes"Abstract: The 5S rRNA genes are among the most conserved nucleotide sequences across all species. Similar to the 5S preservation we observe the occurrence of 5S-related non-autonomous retrotransposons, so-called Cassandra. Cassandras harbor highly conserved 5S rDNA-related sequences within their long terminal repeats (LTRs), advantageously providing them with the 5S internal promoter. However, the dynamics of Cassandra retrotransposon evolution in the context of 5S rRNA gene sequence information and structural arrangement are still unclear, especially: 1) do we observe repeated or gradual domestication of the highly conserved 5S promoter by Cassandras and 2) do changes in 5S organization such as in the linked 35S-5S rDNA arrangements impact Cassandra evolution? Here, we show evidence for gradual co-evolution of Cassandra sequences with their corresponding 5S rDNAs. To follow the impact of 5S rDNA variability on Cassandra TEs, we investigate the Asteraceae family where highly variable 5S rDNAs, including 5S promoter shifts and both linked and separated 35S-5S rDNA arrangements have been reported. Cassandras within the Asteraceae mirror 5S rDNA promoter mutations of their host genome, likely as an adaptation to the host's specific 5S transcription factors and hence compensating for evolutionary changes in the 5S rDNA sequence. Changes in the 5S rDNA sequence and in Cassandras seem uncorrelated with linked/separated rDNA arrangements. We place all these observations into the context of angiosperm 5S rDNA-Cassandra evolution, discuss Cassandra's origin hypotheses (single or multiple) and Cassandra's possible impact on rDNA and plant genome organization, giving new insights into the interplay of ribosomal genes and transposable elements.