Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
215
datasets available to search
ShareScore release 0.9.0
Dataset results
215 results for “cDNA”
SNCA targeted cDNA: PacBio Iso-Seq raw data
<p><strong>The landscape of <em>SNCA</em> transcripts across </strong><strong>synucleinopathies</strong><strong>: New insights from long reads sequencing analysis</strong></p> <p><strong>cDNA capture using IDT xGen</strong><strong>® Lockdown</strong><strong>® Probes and single-molecule Isoform-Sequencing (Iso-Seq)</strong></p> <p>100-150ng of total RNA per reaction was reverse transcribed using the Clontech SMARTer cDNA synthesis kit and 12 sample specific barcoded oligo dT (with PacBio 16mer barcode sequences, see Supplementary Methods). Three reverse transcription (RT) reactions were processed in parallel for each sample. PCR optimization was used to determine the optimal amplification cycle number for the downstream large-scale PCR reactions. A single primer (primer IIA from the Clontech SMARTer kit 5’ AAG CAG TGG TAT CAA CGC AGA GTA C 3’) was used for all PCR reactions post-RT. Large scale PCR products were purified separately with 1X AMPure PB beads and the bioanalyzer was used for QC. An equimolar pool of 12-plex barcoded cDNA library (1µg total) was input into the probe based capture with a custom designed SNCA gene panel.</p> <p>A SMRTBell library was constructed using 874ng of captured and re-amplified cDNA (https://www.pacb.com/wp-content/uploads/Procedure-Checklist-%E2%80%93-cDNA-Capture-Using-IDT-xGen-Lockdown-Probes.pdf). One SMRT Cell (6 hour movie) was sequenced on the PacBio Sequel platform using 2.0 chemistry. </p> <p> </p> <p> </p> <p>The 5’ primer is identical for all patient samples: AAGCAGTGGTATCAACGCAGAGTACATGGG</p> <p>The 3’ primer for the 12 patient samples are below:</p> <p>PD-1: CGCACTCTGATATGTGGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-2: CTCACAGTCTGTGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-3: CTCTCACGAGATGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-4: CGCGCGTGTGTGCGTGGTACTCTGCGTTGATACCACTGCT</p> <p>N-1: ACGCGAGAGTCGAGTGGTACTCTGCGTTGATACCACTGCTT</p> <p>N-2: ACAGCTGATATATATGGTACTCTGCGTTGATACCACTGCTT</p> <p>N-3: CACATAGAGATACAGAGTACTCTGCGTTGATACCACTGCTT</p> <p>N-4: CGCAGCGCTCGACTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-1: TCTGTCTCGCGTGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-2: CTCTGAGATAGCGCGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-3: ATAGATATACGTATAGGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-4: ACACGCGATCTAGTGTGTACTCTGCGTTGATACCACTGCTT</p>
Data from: Characterization of leukemia-inducing genes using a proto-oncogene/homeobox gene retroviral human cDNA library in a mouse in vivo model
Open the record for dataset details and reuse information.
Expression profiling of murine hemopoietic cell survival on cDNA arrays.
GEO Series GSE18221. Mus musculus. 14 samples. Type: Expression profiling by array.
Technical Analysis of Fundulus heteroclitus cDNA Microarrays, experiment A
GEO Series GSE12858. Fundulus heteroclitus. 5 samples. Type: Expression profiling by array.
cDNA microarray analysis of splenic B220+CD138+ plasma cells from K/BxNsf and K/BxN mice
GEO Series GSE66947. Mus musculus. 2 samples. Type: Expression profiling by array.
5CAPture-seq: a method for enriching full-length cDNA and identifying 5′ capped nucleotides
GEO Series GSE103036. Plasmodium falciparum. 24 samples. Type: Expression profiling by high throughput sequencing.
cDNA microarray analysis comparing transcription levels in the heads of control and hangAE10 mutants of D. melanogaster
GEO Series GSE91049. Drosophila melanogaster. 5 samples. Type: Expression profiling by array.
Expression profiling of p53-regulated genes by cDNA microarray analysis
GEO Series GSE14953. Homo sapiens. 5 samples. Type: Expression profiling by array.
cDNA microarray expression profile during fiber elongation between G. hirsutum and G. barbadense
GEO Series GSE18028. Gossypium barbadense; Gossypium hirsutum. 15 samples. Type: Expression profiling by array.
Targeted gene editing and near-universal cDNA insertion of CYBA and CYBB as a treatment for chronic granulomatous disease
GEO Series GSE287370. Homo sapiens. 3 samples. Type: Other.
Nanopore sequencing unveils the complexity of the murine brown adipose tissue transcriptome: ONT direct cDNA-Seq of iBAT from cold treated mice [04_iBAT_cdna]
GEO Series GSE212572. Mus musculus. 6 samples. Type: Expression profiling by high throughput sequencing.
Transcriptional profiling during pollination in Ophrys fusca, through cDNA microarrays
GEO Series GSE28273. Ophrys fusca. 14 samples. Type: Expression profiling by array.
Identification of rust-induced genes in poplar using Populus 4.6K cDNA macroarray
GEO Series GSE7121. Populus trichocarpa x Populus deltoides. 27 samples. Type: Expression profiling by array.
cDNA microarray analysis of miR-1 transfected HeLa and NPC-TW01 cells
GEO Series GSE28522. Homo sapiens. 2 samples. Type: Expression profiling by array.
TAcKLE - Transcriptome Amplification and cDNA Labeling for Expression analysis
GEO Series GSE1645. Homo sapiens. 20 samples. Type: Expression profiling by array.
A novel NGS-based method can improve the efficiency and sensitivity of Y2H screening with cDNA library
GEO Series GSE179488. Arabidopsis thaliana. 9 samples. Type: Other.
cDNA sequencing of Plasmodium falciparum field parasites 2015-2018
GEO Series GSE169520. Plasmodium falciparum. 380 samples. Type: Expression profiling by high throughput sequencing.
X chromosome cDNA microarray screen of lymphoblasts from males with XLMR
GEO Series GSE7470. Homo sapiens. 49 samples. Type: Expression profiling by array.
Single cell RNA-seq data of human hESCs comparing experiments with cDNA library equalization
GEO Series GSE156494. Homo sapiens. 288 samples. Type: Expression profiling by high throughput sequencing.
Human Breast Cells: Control vs. TRIM29 cDNA- or TRIM29 shRNA-transfected
GEO Series GSE26238. Homo sapiens. 4 samples. Type: Expression profiling by array.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.