Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
325
datasets available to search
ShareScore release 0.9.0
Dataset results
325 results for “molecular phylogenetic analysis”
Fig. 1 in Molecular characterization and phylogenetic analysis of Trypanosoma spp. detected from striped leaf-nosed bats (Hipposideros vittatus) in Zambia
Fig. 1. Giemsa staining of Trypanosoma sp. from ZB17–105 in BSK-M medium Representative images of ZB17-105 in the BSK-M medium are displayed at the same magnification (x1000). (a,b) flagellates resembling promastigote forms. (c) possibly epimastigote forms under division. K: kinetoplast, N: nucleus, F: flagellum.
Text-fig. 1. D&E tree of Endress and Doyle (2009), from the combined morphological and molecular analysis of Doyle and Endress (2000), with modifications based on more recent data, showing the inferred evolution of the reticulum grading character (39). Boxes under names of taxa indicate their character state; shading of branches indicates their reconstructed state based on parsimony optimization with MacClade (Maddison and Maddison 2003). Nymph = Nymphaeales, Aust = Austrobaileyales, Chlor = Chloranthaceae, Piper = Piperales, Ca = Canellales, Magnol = Magnoliales. in Early Cretaceous Monocots: A Phylogenetic Evaluation
Text-fig. 1. D&E tree of Endress and Doyle (2009), from the combined morphological and molecular analysis of Doyle and Endress (2000), with modifications based on more recent data, showing the inferred evolution of the reticulum grading character (39). Boxes under names of taxa indicate their character state; shading of branches indicates their reconstructed state based on parsimony optimization with MacClade (Maddison and Maddison 2003). Nymph = Nymphaeales, Aust = Austrobaileyales, Chlor = Chloranthaceae, Piper = Piperales, Ca = Canellales, Magnol = Magnoliales.
Fig. 4. Phylogenetic analysis. Molecular analyses identified the specimens collected from CBW2 and CBW3 in Crassicaudiasis in three geographically and chronologically distant Cuvier's beaked whales (Ziphius cavirostris) stranded off Brazil
Fig. 4. Phylogenetic analysis. Molecular analyses identified the specimens collected from CBW2 and CBW3 as Crassicauda anthonyi, based on the ITS2 region, and supported by phylogenetic analysis. Analysis was performed by MEGA X 10.1 using the maximum likelihood method (1,000 bootstrap replicates) and included Habronema muscae as outgroup. GenBank accession numbers are listed along the species names. Branches with bootstrap support lower than 50% were collapsed. *Sequences obtained in this study.
Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.
Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.
Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Figure 40 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 40. Phylogenetic hypothesis for Bullidae species based on Bayesian inference analysis of COI gene sequences. Numbers above branches are posterior probabilities expressed as percentages. Outgroups have been removed from the tree.
Figure 35 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 35. Male genital system (with details of prostate and penial duct) of Bulla ampulla (A–H) and B. arabica sp. nov. (I–K). A, B, Umhlali, South Africa (NM Moll w2407; H = 38.3 mm). C, D, Taolagnaro, Madagascar (BNMH 20030672; H = 41.0 mm). E, New Britain, Papua New Guinea (ZMB 38888; H = 33.6 mm). F, G, Tuticorin, India (BMNH 20050164; H = 41.6 mm). H, Nacala, Mozambique (BMNH 20060528; H = 47.8 mm). I, Red Sea (ZMB 789; H = 25.5 mm). J, Khasab, Oman (BMNH 20060565; H = 35.9 mm). K, Ras al- Khaimah, United Arab Emirates (BMNH 20060101; H = 42.2 mm).
Figure 32 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 32. Rachidian teeth of radula of Bulla ampulla (A, B), B. arabica sp. nov. (C), B. orientalis (D), B. quoyii (E) and B. vernicosa (F). A, Umhlali, South Africa (NM W2407; H = 38.7 mm). B, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). C, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6). D, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). E, Albany, Western Australia (WAM S19095; H = 45.9 mm). F, Panglao, Philippines (MNHN, Paris; H = 27.7 mm). Scale bars: A–D, F = 200 Mm; E = 500 Mm.
Figure 31 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 31. Outer lateral teeth of radula of Bulla ampulla (A–C), B. arabica sp. nov. (D), B. orientalis (E), B. quoyii (F) and B. vernicosa (G–H). A, Umhlali, South Africa (NM W2407; H = 38.7 mm). B, Kagoshima, Japan (BMNH 20060106; H = 37.0). C, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). D, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6 mm). E, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). F, Auckland, New Zealand (BMNH 20030345; H = 27.1 mm). G, Panglao, Philippines (MNHN, Paris; H = 27.7 mm). H, Morobe, Papua New Guinea (AMS C444875; H = 31.2). Scale bars: A, B, D, F = 200 Mm; C, E, G, H = 100 Mm.
Figure 30 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 30. Radula, inner lateral teeth of Bulla ampulla (A–C), B. arabica sp. nov. (D), B. orientalis (E), B. quoyii (F) and B. vernicosa (G, H). A, Taolagnaro, Madagascar (BMNH 20030672/1; H = 47.0 mm). B, Kagoshima, Japan (BMNH 20060106; H = 37.0 mm). C, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). D, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6 mm). E, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). F, Albany, Western Australia (WAM S19095; H = 45.9 mm). G, Dili, East Timor (BMNH 20040857; H = 25.0 mm). H, Morobe, Papua New Guinea (AMS C444875; H = 31.2). Scale bars: A–H = 100 Mm.
Figure 29 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 29. Jaws of Bulla ampulla (A, B), B. arabica sp. nov. (C), B. orientalis (D), B. quoyii (E), and B. vernicosa (F). A, Taolagnaro, Madagascar (BMNH 20030672/1; H = 47.0 mm; arrows point to ciliary veil around mouth). B, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). C, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6 mm). D, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). E, Albany, Western Australia (WAM S19095; H = 42.7 mm). F, Dili, East Timor (BMNH 20040857; H = 25.0 mm). Scale bars: A = 1 mm; B = 20 Mm; C–F = 500 Mm. Arrows in B–F point towards functional margin of jaw.
Figure 24 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 24. Variability in the female glands of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E–G) and B. punctulata (H, I). Dorsal views depicted in A, E, H and anterior ventral views in B, D, F, G, Island A, Tenerife, Canary Islands (BMNH 20050711; H = 29.7 mm). B, Tenerife, Canary Islands (BMNH 20030774; H = 48.4 mm). C, D, off Florida (HBOM 65-281; H = 38.4 mm). E, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). F, Baja California, Mexico (CAS 067260; H = 33.9 mm). G, Baja California, Mexico (CAS 101586; H = 28.3 mm). H, I, Santa Cruz Island, Galapagos Islands (CAS 067270; H = 16.5, 18.1 mm).
Figure 23 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 23. Male genital system (with details of prostate and penial duct) of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E–G) and B. punctulata (H, I). A, Tenerife, Canary Islands (BMNH 20050711; H = 29.7 mm). B, Tenerife, Canary Islands (BMNH 20030774; H = 48.4 mm). C, off Florida (HBOM 65-282; H = 35.1 mm). D, off Florida (HBOM 62–281; H = 39.4 mm). E-F, Baja California, Mexico (CAS 067260; H = 35.4, 33.9 mm). G, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). H, Santa Cruz Island, Galapagos Islands (CAS 067270; H = 18.1 mm). I, Puntarenas, Costa Rica (INBio 01482898; H = 19.6 mm).
Figure 22 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 22. Gizzard spines of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E, F), and B. punctulata (G–H). A, Tenerife, Canary Islands (BMNH 20030774; H = 48.4 mm). B, Tenerife, Canary Islands (BMNH 20050711; H = 29.7 mm). C, D, off Florida (HBOM 62-281; H = 34.9 mm). E, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). F, Baja California, Mexico (CAS 101586; H = 28.7 mm). G, H, Puntarenas, Costa Rica (INBio 01482898; H = 16.00, 19.6 mm). Scale bars: A, B, G = 500 Mm; C, E = 2 mm; D, F = 1 mm; H = 200 Mm.
Figure 33 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 33. Gizzard plates of Bulla ampulla (A–D), B. arabica sp. nov. (E, F), and B. orientalis (G, H). A, Tuticorin, India (BMNH 20050164; H = 43.9 mm). B, Kagoshima, Japan (BMNH 20060106; H = 37.0 mm). C, New Britain, Papua New Guinea (ZMB 38888; H = 33.6 mm). D, North-west Cape, Western Australia (WAM S19141; H = 38.4 mm). E, Gulf of Aqabar, Egypt (BMNH 20060555; H = 26.4 mm). F, Khasab, Oman (BMNH 20065365; H = 35.9 mm). G, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). H, Taolagnaro, Madagascar (BMNH 20030672/2; H = 27.8 mm). Scale bars: A–H = 2 mm.
Figure 18 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 18. Inner lateral teeth of radula of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E, F), and B. punctulata (G, H). A, Tenerife Island, Canary Islands (BMNH 20020457; H = 26.9 mm). B, Tenerife Island, Canary Islands (BMNH 20030774; H = 48.4 mm). C, off Florida (HBOM 62–281; H = 38.4 mm). D, off Florida (HBOM 62–281; H = 38.4 mm). E, Baja California, Mexico (CAS 101586; H = 28.4 mm). F, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). G, Santa Cruz Island, Galapagos (CAS 067270; H = 18.1 mm). H, Guanacaste, Costa Rica (INBio 03458490; H = 14.9 mm). Scale bars: A, C–H = 100 Mm; B = 200 Mm.
Figure 17 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis
Figure 17. Geographical distribution of Bulla gouldiana and B. punctulata based on material examined and quoted literature records (A – Bartsch & Rehder, 1939; Emerson, 1995; B – Montoya, 1983).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.