Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

325

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

325 results for “molecular phylogenetic analysis”

Learn how ShareScore rates datasets ↗
zenodo40/100

Fig. 1 in Molecular characterization and phylogenetic analysis of Trypanosoma spp. detected from striped leaf-nosed bats (Hipposideros vittatus) in Zambia

Fig. 1. Giemsa staining of Trypanosoma sp. from ZB17–105 in BSK-M medium Representative images of ZB17-105 in the BSK-M medium are displayed at the same magnification (x1000). (a,b) flagellates resembling promastigote forms. (c) possibly epimastigote forms under division. K: kinetoplast, N: nucleus, F: flagellum.

opencc-by-4.0Aug 2019View details →
zenodo40/100

Text-fig. 1. D&E tree of Endress and Doyle (2009), from the combined morphological and molecular analysis of Doyle and Endress (2000), with modifications based on more recent data, showing the inferred evolution of the reticulum grading character (39). Boxes under names of taxa indicate their character state; shading of branches indicates their reconstructed state based on parsimony optimization with MacClade (Maddison and Maddison 2003). Nymph = Nymphaeales, Aust = Austrobaileyales, Chlor = Chloranthaceae, Piper = Piperales, Ca = Canellales, Magnol = Magnoliales. in Early Cretaceous Monocots: A Phylogenetic Evaluation

Text-fig. 1. D&E tree of Endress and Doyle (2009), from the combined morphological and molecular analysis of Doyle and Endress (2000), with modifications based on more recent data, showing the inferred evolution of the reticulum grading character (39). Boxes under names of taxa indicate their character state; shading of branches indicates their reconstructed state based on parsimony optimization with MacClade (Maddison and Maddison 2003). Nymph = Nymphaeales, Aust = Austrobaileyales, Chlor = Chloranthaceae, Piper = Piperales, Ca = Canellales, Magnol = Magnoliales.

opencc-by-4.0Dec 2008View details →
zenodo40/100

Fig. 4. Phylogenetic analysis. Molecular analyses identified the specimens collected from CBW2 and CBW3 in Crassicaudiasis in three geographically and chronologically distant Cuvier's beaked whales (Ziphius cavirostris) stranded off Brazil

Fig. 4. Phylogenetic analysis. Molecular analyses identified the specimens collected from CBW2 and CBW3 as Crassicauda anthonyi, based on the ITS2 region, and supported by phylogenetic analysis. Analysis was performed by MEGA X 10.1 using the maximum likelihood method (1,000 bootstrap replicates) and included Habronema muscae as outgroup. GenBank accession numbers are listed along the species names. Branches with bootstrap support lower than 50% were collapsed. *Sequences obtained in this study.

opencc-by-4.0Dec 2021View details →
zenodo40/100

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Figure 40 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 40. Phylogenetic hypothesis for Bullidae species based on Bayesian inference analysis of COI gene sequences. Numbers above branches are posterior probabilities expressed as percentages. Outgroups have been removed from the tree.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 35 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 35. Male genital system (with details of prostate and penial duct) of Bulla ampulla (A–H) and B. arabica sp. nov. (I–K). A, B, Umhlali, South Africa (NM Moll w2407; H = 38.3 mm). C, D, Taolagnaro, Madagascar (BNMH 20030672; H = 41.0 mm). E, New Britain, Papua New Guinea (ZMB 38888; H = 33.6 mm). F, G, Tuticorin, India (BMNH 20050164; H = 41.6 mm). H, Nacala, Mozambique (BMNH 20060528; H = 47.8 mm). I, Red Sea (ZMB 789; H = 25.5 mm). J, Khasab, Oman (BMNH 20060565; H = 35.9 mm). K, Ras al- Khaimah, United Arab Emirates (BMNH 20060101; H = 42.2 mm).

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 32 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 32. Rachidian teeth of radula of Bulla ampulla (A, B), B. arabica sp. nov. (C), B. orientalis (D), B. quoyii (E) and B. vernicosa (F). A, Umhlali, South Africa (NM W2407; H = 38.7 mm). B, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). C, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6). D, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). E, Albany, Western Australia (WAM S19095; H = 45.9 mm). F, Panglao, Philippines (MNHN, Paris; H = 27.7 mm). Scale bars: A–D, F = 200 Mm; E = 500 Mm.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 31 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 31. Outer lateral teeth of radula of Bulla ampulla (A–C), B. arabica sp. nov. (D), B. orientalis (E), B. quoyii (F) and B. vernicosa (G–H). A, Umhlali, South Africa (NM W2407; H = 38.7 mm). B, Kagoshima, Japan (BMNH 20060106; H = 37.0). C, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). D, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6 mm). E, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). F, Auckland, New Zealand (BMNH 20030345; H = 27.1 mm). G, Panglao, Philippines (MNHN, Paris; H = 27.7 mm). H, Morobe, Papua New Guinea (AMS C444875; H = 31.2). Scale bars: A, B, D, F = 200 Mm; C, E, G, H = 100 Mm.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 30 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 30. Radula, inner lateral teeth of Bulla ampulla (A–C), B. arabica sp. nov. (D), B. orientalis (E), B. quoyii (F) and B. vernicosa (G, H). A, Taolagnaro, Madagascar (BMNH 20030672/1; H = 47.0 mm). B, Kagoshima, Japan (BMNH 20060106; H = 37.0 mm). C, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). D, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6 mm). E, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). F, Albany, Western Australia (WAM S19095; H = 45.9 mm). G, Dili, East Timor (BMNH 20040857; H = 25.0 mm). H, Morobe, Papua New Guinea (AMS C444875; H = 31.2). Scale bars: A–H = 100 Mm.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 29 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 29. Jaws of Bulla ampulla (A, B), B. arabica sp. nov. (C), B. orientalis (D), B. quoyii (E), and B. vernicosa (F). A, Taolagnaro, Madagascar (BMNH 20030672/1; H = 47.0 mm; arrows point to ciliary veil around mouth). B, Abrolhos Islands, Western Australia (WAM S19151; H = 45.4 mm). C, Ras al-Khaimah, United Arab Emirates (BMNH 20060102; H = 39.6 mm). D, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). E, Albany, Western Australia (WAM S19095; H = 42.7 mm). F, Dili, East Timor (BMNH 20040857; H = 25.0 mm). Scale bars: A = 1 mm; B = 20 Mm; C–F = 500 Mm. Arrows in B–F point towards functional margin of jaw.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 24 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 24. Variability in the female glands of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E–G) and B. punctulata (H, I). Dorsal views depicted in A, E, H and anterior ventral views in B, D, F, G, Island A, Tenerife, Canary Islands (BMNH 20050711; H = 29.7 mm). B, Tenerife, Canary Islands (BMNH 20030774; H = 48.4 mm). C, D, off Florida (HBOM 65-281; H = 38.4 mm). E, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). F, Baja California, Mexico (CAS 067260; H = 33.9 mm). G, Baja California, Mexico (CAS 101586; H = 28.3 mm). H, I, Santa Cruz Island, Galapagos Islands (CAS 067270; H = 16.5, 18.1 mm).

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 23 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 23. Male genital system (with details of prostate and penial duct) of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E–G) and B. punctulata (H, I). A, Tenerife, Canary Islands (BMNH 20050711; H = 29.7 mm). B, Tenerife, Canary Islands (BMNH 20030774; H = 48.4 mm). C, off Florida (HBOM 65-282; H = 35.1 mm). D, off Florida (HBOM 62–281; H = 39.4 mm). E-F, Baja California, Mexico (CAS 067260; H = 35.4, 33.9 mm). G, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). H, Santa Cruz Island, Galapagos Islands (CAS 067270; H = 18.1 mm). I, Puntarenas, Costa Rica (INBio 01482898; H = 19.6 mm).

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 22 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 22. Gizzard spines of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E, F), and B. punctulata (G–H). A, Tenerife, Canary Islands (BMNH 20030774; H = 48.4 mm). B, Tenerife, Canary Islands (BMNH 20050711; H = 29.7 mm). C, D, off Florida (HBOM 62-281; H = 34.9 mm). E, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). F, Baja California, Mexico (CAS 101586; H = 28.7 mm). G, H, Puntarenas, Costa Rica (INBio 01482898; H = 16.00, 19.6 mm). Scale bars: A, B, G = 500 Mm; C, E = 2 mm; D, F = 1 mm; H = 200 Mm.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 33 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 33. Gizzard plates of Bulla ampulla (A–D), B. arabica sp. nov. (E, F), and B. orientalis (G, H). A, Tuticorin, India (BMNH 20050164; H = 43.9 mm). B, Kagoshima, Japan (BMNH 20060106; H = 37.0 mm). C, New Britain, Papua New Guinea (ZMB 38888; H = 33.6 mm). D, North-west Cape, Western Australia (WAM S19141; H = 38.4 mm). E, Gulf of Aqabar, Egypt (BMNH 20060555; H = 26.4 mm). F, Khasab, Oman (BMNH 20065365; H = 35.9 mm). G, Okinawa, Japan (BMNH 20040859; H = 22.0 mm). H, Taolagnaro, Madagascar (BMNH 20030672/2; H = 27.8 mm). Scale bars: A–H = 2 mm.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 18 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 18. Inner lateral teeth of radula of Bulla mabillei (A, B), B. solida (C, D), B. gouldiana (E, F), and B. punctulata (G, H). A, Tenerife Island, Canary Islands (BMNH 20020457; H = 26.9 mm). B, Tenerife Island, Canary Islands (BMNH 20030774; H = 48.4 mm). C, off Florida (HBOM 62–281; H = 38.4 mm). D, off Florida (HBOM 62–281; H = 38.4 mm). E, Baja California, Mexico (CAS 101586; H = 28.4 mm). F, Baja California, Mexico (BMNH 20050366; H = 25.4 mm). G, Santa Cruz Island, Galapagos (CAS 067270; H = 18.1 mm). H, Guanacaste, Costa Rica (INBio 03458490; H = 14.9 mm). Scale bars: A, C–H = 100 Mm; B = 200 Mm.

opencc-by-4.0Jul 2008View details →
zenodo40/100

Figure 17 in Systematic revision of the living species of Bullidae (Mollusca: Gastropoda: Cephalaspidea), with a molecular phylogenetic analysis

Figure 17. Geographical distribution of Bulla gouldiana and B. punctulata based on material examined and quoted literature records (A – Bartsch & Rehder, 1939; Emerson, 1995; B – Montoya, 1983).

opencc-by-4.0Jul 2008View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record