Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
79
datasets available to search
ShareScore release 0.9.0
Dataset results
79 results for “plant database”
Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Fabaceae family, conserved at the CNARP herbarium.
Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Fabaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/72414bd9-69dc-461c-8034-b7d895eccf63">https://bionomia.net/dataset/72414bd9-69dc-461c-8034-b7d895eccf63</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/72414bd9-69dc-461c-8034-b7d895eccf63">https://gbif.org/dataset/72414bd9-69dc-461c-8034-b7d895eccf63</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Sapotaceae family, owned by CNARP.
Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Sapotaceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/65174786-b679-46f1-b5a4-34f466e9241a">https://bionomia.net/dataset/65174786-b679-46f1-b5a4-34f466e9241a</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/65174786-b679-46f1-b5a4-34f466e9241a">https://gbif.org/dataset/65174786-b679-46f1-b5a4-34f466e9241a</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Asteraceae family, conserved at the CNARP herbarium.
Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Asteraceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3">https://bionomia.net/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3">https://gbif.org/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Moraceae family, owned by CNARP.
Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Moraceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0">https://bionomia.net/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0">https://gbif.org/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Euphorbiaceae family, conserved at the CNARP herbarium.
Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Euphorbiaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/073938a7-50e8-446e-8884-035b0639982c">https://bionomia.net/dataset/073938a7-50e8-446e-8884-035b0639982c</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/073938a7-50e8-446e-8884-035b0639982c">https://gbif.org/dataset/073938a7-50e8-446e-8884-035b0639982c</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Apocynaceae family, owned by CNARP.
Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Apocynaceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb">https://bionomia.net/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb">https://gbif.org/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb</a>. Formatted as a Frictionless Data package.
Russian Arctic Vegetation Archive – a new database of plant community composition and environmental conditions
<p><span>The goal of the Russian Arctic Vegetation Archive is to unite and harmonize data of plot-based plant species and their abundance, vegetation structure and environmental variables from the Russian Arctic (including historical Soviet data). This database can be used to assess the status of the Russian Arctic vegetation and as a baseline to assess biodiversity changes in the future. The archive can be used for scientific studies as well as to inform nature protection and restoration efforts.</span></p>
rCRUX Generated ITS2 Plants Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: ITS2 Plants<br> Gene: ITS2<br> Length of Target: 450-550<br> get_seeds_local() minimum length: 315<br> get_seeds_local() maximum length: 600<br> blast_seeds() minimum length: 270<br> blast_seeds() maximum length: 560<br> max_to_blast: 100<br> Forward Sequence (5'-3'): ATGCGATACTTGGTGTGAAT<br> Reverse Sequence (5'-3'): GACGCTTCTCCAGACTACAAT<br> Reference: Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... & Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. <a href="https://doi.org/10.1371/journal.pone.0067818">https://doi.org/10.1371/journal.pone.0067818</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
rCRUX Generated trnl plants Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: trnl plants<br> Gene: trnl<br> Length of Target: ~85<br> get_seeds_local() minimum length: 60<br> get_seeds_local() maximum length: 110<br> blast_seeds() minimum length: 23<br> blast_seeds() maximum length: 73<br> max_to_blast: 250<br> Forward Sequence (5'-3'): GGGCAATCCTGAGCCAA<br> Reverse Sequence (5'-3'): TTTGAGTCTCTGCACCTATC<br> Reference: Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... & Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007). https://doi.org/10.1093%2Fnar%2Fgkl938</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Russian Arctic Vegetation Archive – a new database of plant community composition and environmental conditions
Open the record for dataset details and reuse information.
Master Plant Species Information Database for the Sevilleta National Wildlife Refuge, New Mexico (1989-1996)
This data base contains taxonomic and ecological information for the plant species on the Sevilleta National Wildlife Refuge.
JRC Open Power Plants Database (JRC-PPDB-OPEN)
<p>In 2017 the Joint Research Centre developed a Power Plant Database for energy systems modelling (JRC-PPDB) in order to support the unit activities in energy systems modelling and knowledge management.</p> <p>As demand for open data is increasingly sought after, an open version (JRC-PPDB-OPEN), based on exclusively open data was designed. The JRC-PPDB-OPEN is primarily based on a collection of all the information published by ENTSO-E<a href="#_ftn1">[1]</a> on the European power plants at unit level. This information was extended, improved, and where possible corrected using information contained in open datasets published by WRI Powerwatch<a href="#_ftn2">[2]</a>, Global energy observatory<a href="#_ftn3">[3]</a>, FRESNA<a href="#_ftn4">[4]</a> and the EEA<a href="#_ftn5">[5]</a>.</p> <p>The JRC-PPDB-OPEN database is a first attempt towards a more detailed and coherent, albeit still incomplete, dataset of European power plants. Further work to expand and improve the information contained therein is called for. To this extend, and in order to facilitate the future involvement of third parties in such efforts, the associations between records in the different datasets (linkage) are included.</p> <p> </p> <p><a href="#_ftnref1">[1]</a> <a href="https://transparency.entsoe.eu/">https://transparency.entsoe.eu/</a></p> <p><a href="#_ftnref2">[2]</a> <a href="http://datasets.wri.org/dataset/globalpowerplantdatabase">http://datasets.wri.org/dataset/globalpowerplantdatabase</a></p> <p><a href="#_ftnref3">[3]</a> <a href="http://globalenergyobservatory.org/">http://globalenergyobservatory.org/</a></p> <p><a href="#_ftnref4">[4]</a> <a href="https://github.com/FRESNA/powerplantmatching">https://github.com/FRESNA/powerplantmatching</a></p> <p><a href="#_ftnref5">[5]</a> <a href="https://prtr.eea.europa.eu/#/home">https://prtr.eea.europa.eu/#/home</a></p>
FLAMITS: FLAMmability plant traiTS database
<p><span>FLAMITS database</span> contains 19,972 records of 40 flammability variables (classified according to the measured component of flammability). For each record, relevant details of the flammability experiment are included, such as the burning device, the ignition source, and the burned plant part. In addition, FLAMITS compiles taxonomic and functional data of the studied species and information on the study site (locality, geographic coordinates, biome, biogeographic realm, and fire activity). We compiled data from 295 studies located in 39 countries and distributed across 12 biomes worldwide over the last 62.5 years (1961 to 15th May 2023). The dataset has 1790 plant taxa from 186 families, 833 genera, and 1790 species.</p>
Database of plant-flower visitor interactions from Ireland
<p><span>Beneficial insects provide valuable services upon which we rely, including pollination. Pollinator conservation is a global priority, and a significant concern in Ireland, where over half of extant bee species have declined significantly in recent decades. As flower-visiting insects rely on flowering plants, one way to conserve and promote pollinator populations is to protect high-quality habitat. We analysed the structure of </span><span>insect-flower interactions</span><span> from multiple habitat categories in a large database of interactions from Ireland. Our primary goals were to compare spatial and temporal variation in Irish network structures, compare Irish networks to published networks from other countries, and provide evidence-based recommendations for pollinator conservation in Ireland by identifying well-visited plant species that may promote high pollinator diversity, abundance, and functional complementarity. Habitat types within Ireland differed substantially: semi-natural grasslands had the highest pollinator species richness and largest number of unique pollinator species, while intensively-managed habitats exhibited negative asymmetry (more plant than pollinator species). This negative asymmetry is notable because most plant-pollinator networks exhibit a positive asymmetry. Within intensively-managed habitats, agricultural and urban habitats differed. Urban habitats had the highest number of non-native plant species while agricultural habitats had the lowest pollinator species richness. We also found Irish networks varied across the growing season, where July had the highest plant and insect species richness. When comparing Irish networks to published networks from other countries, we found Irish networks had a higher ratio of plant species to pollinator species, and that this difference was most evident in agricultural habitats. This ratio means the typical network asymmetry (more pollinator than plant species) was flipped (more plant than pollinator species) in the Irish network. We conclude that conserving semi-natural grasslands in Ireland will be an essential component of pollinator conservation and identify thirty-five plant species important for restoring semi-natural habitats.</span></p>
Mining Proteomic Databases of a Model Plant Medicago truncatula for Mosaic Proteins and Other Unconventional Translation Products
<p><strong>How many different proteins can be produced from a single spliced transcript? Genome annotation projects do not consider the coding potential of reading frames other than that of the reference open reading frames (refORFs). Recently, alternative open reading frames (altORFs) and their translational products, alternative proteins (altProts), have been shown to carry out important functions in various organisms. Overlapping altORFs may be involved in one fundamental mechanism so far overlooked. A few years ago, it was proposed that altORFs may act as building blocks for chimeric (mosaic) polypeptides, which are produced via multiple ribosomal frameshifting events from a single mature transcript. We adopt terminology from that earlier discussion and call this mechanism mosaic translation. This way of extracting and combining genetic information may significantly increase proteome diversity. Thus, we hypothesize that this mechanism may have contributed to the flexibility and adaptability of organisms to a variety of environmental conditions. The idea of mosaic translation is a testable hypothesis, although its direct demonstration is technically very challenging. If confirmed, this concept will revolutionize modern genetics. In this project, we would like to follow a unique strategy for the detection of mosaic proteins in proteomic databases publicly available for a very important model plant <em>Medicago truncatula</em>. The proposed analysis will be based on our own preliminary data already generated in the course of an ongoing TÜBİTAK1002 project. Regardless of whether the evidence for mosaic translation is found in this study, this effort will help identify such proteins later when more proteomic data become available. Finally, our approach can reveal unconventional frameshifting products that derive from the omission of several nucleotides by ribosomes (for example, +2 to +16 frameshifts). Regardless of whether such frameshifted products are parts of mosaic proteins, the potential for their detection makes this project very novel, because frameshifts longer than one nucleotide in the forward direction have not been described so far.</strong></p>
SurEau database : A database of hydraulic and stomatal traits for modelling drought resistance in plants
<p>This file contains a database of hydraulic and stomatal traits that accompanies the paper untitled "Pant resistance to drought relies on timely stomatal closure" publish in Ecology Letters. This database was used to built the Figure of this manuscript.</p> <p>> The first page ("Stem_VCurves") contains the parameter of vulnerability curve to embolism for 150 species. Family, genus and species names as well as original reference are provided.</p> <p>> The second page ("Pgs90") contains a first proxy for the water potential causing stomatal closure, it is the value of water potential causing 90% stomatal closure computed from gs versus water potential. Family, genus and species names as well as original reference are provided.</p> <p>> The third page (Ptlp) contains a second proxy for the water potential causing stomatal closure, it is the turgor loss point computed from pressure volume curves. Family, genus and species names as well as original reference are provided.</p> <p>> The fourth page (ALL) contains all the three previous pages together, allowing to reconstruct Figure 1.</p> <p>> The fifth page (PitlpAdultSeedlings) contains values of turgor loss point for adults and seedilngs for 15 species.</p> <p>> The sixth page (P50AdultSeedlings) contains values of embolism resistance for adults and seedilngs for 14 species.</p> <p>> The seventh page (Emin) contains values of minimum (i.e. cuticular) conductance and minimum transpiration for 33 species as well as embolism resistance values for theese species.</p> <p> </p> <p> </p> <p> </p> <p> </p>
African wood density database with matches to the taxonomic backbone data sets of World Flora Online (version 2023.12) and the World Checklist of Vascular Plants (version 11)
<p>The <strong><span>African Wood Density Database </span></strong><span>provides air-dry wood density data for over 750 tree species grown in Africa.</span></p> <p>This archive provides taxonomic matches with recent versions of <strong>World Flora Online</strong> (WFO; <a href="../records/10425161">version 2023.12 downloaded from Zenodo</a>; Borch et al. <a href="https://onlinelibrary.wiley.com/doi/10.1002/tax.12373">2020</a>) and the <strong>World Checklist of Vascular Plants</strong> (WCVP; <a href="https://sftp.kew.org/pub/data-repositories/WCVP/Archive/">version 11 downloaded from the Kew data depository</a>; Govaerts et al. <a href="https://doi.org/10.1038/s41597-021-00997-6">2021</a>). Matching was done via the <strong>WorldFlora</strong> package (<a href="https://cran.r-project.org/package=WorldFlora">version 1.14-3</a>; Kindt <a href="https://bsapubs.onlinelibrary.wiley.com/doi/full/10.1002/aps3.11388">2020</a>), using similar scripts as documented in this Rpub: <a href="https://rpubs.com/Roeland-KINDT/1134151">https://rpubs.com/Roeland-KINDT/1134151</a>.</p> <p> </p> <ul> <li><span>Carsan, S. Orwa, C. Harwood, C. Kindt, R. Stroebel, A. Neufeldt, H. and Jamnadass, R. 2012. African Wood Density Database. World Agroforestry Centre, Nairobi. <a href="https://apps.worldagroforestry.org/treesnmarkets/wood/">https://apps.worldagroforestry.org/treesnmarkets/wood/#</a> </span></li> <li><span>Borsch, T., Berendsohn, W., Dalcin, E., Delmas, M., Demissew, S., Elliott, A., Fritsch, P., Fuchs, A., Geltman, D., Güner, A., Haevermans, T., Knapp, S., le Roux, M.M., Loizeau, P.-A., Miller, C., Miller, J., Miller, J.T., Palese, R., Paton, A., Parnell, J., Pendry, C., Qin, H.-N., Sosa, V., Sosef, M., von Raab-Straube, E., Ranwashe, F., Raz, L., Salimov, R., Smets, E., Thiers, B., Thomas, W., Tulig, M., Ulate, W., Ung, V., Watson, M., Jackson, P.W. and Zamora, N. (2020), World Flora Online: Placing taxonomists at the heart of a definitive and comprehensive global resource on the world's plants. TAXON, 69: 1311-1341. <a href="https://doi.org/10.1002/tax.12373">https://doi.org/10.1002/tax.12373</a></span></li> <li><span>Govaerts, R., Nic Lughadha, E., Black, N. <em>et al.</em> The World Checklist of Vascular Plants, a continuously updated resource for exploring global plant diversity. <em>Sci Data</em> <strong>8</strong>, 215 (2021). <a href="https://doi.org/10.1038/s41597-021-00997-6">https://doi.org/10.1038/s41597-021-00997-6</a></span></li> <li><span>Kindt, R. 2020. WorldFlora: An R package for exact and fuzzy matching of plant names against the World Flora Online taxonomic backbone data. <em>Applications in Plant Sciences</em> 8(9): e11388. <a href="https://doi.org/10.1002/aps3.11388">https://doi.org/10.1002/aps3.11388</a></span></li> </ul> <p> </p> <p>Original funding for the database was provided <span>by the Carbon Benefits Project (CBP) supported by The Global Environment Facility (GEF). Development of the 2024 version </span>was supported by the <strong>Darwin Initiative</strong> to project DAREX001 of <em>Developing a Global Biodiversity Standard certification for tree-planting and restoration</em>, by <strong>Norway’s International Climate and Forest Initiative through the Royal Norwegian Embassy in Ethiopia</strong> to the <em>Provision of Adequate Tree Seed Portfolio</em> project in Ethiopia, by the <strong>Green Climate Fund</strong> through the IUCN-led <em>Transforming the Eastern Province of Rwanda through Adaptation</em> project and through the <em>Readiness proposal on Climate Appropriate Portfolios of Tree Diversity for Burkina Faso</em>, by the <strong>Bezos Earth Fund</strong> to the <em>Bezos Quality Tree Seed for Africa in Kenya and Rwanda</em> project and by the <strong>German International Climate Initiative (IKI)</strong> to the regional tree seed programme on <em>The Right Tree for the Right Place for the Right Purpose in Africa</em>. When using <strong>African Wood Density database</strong> in your work, cite the 2012 version (Carsan et al. <a href="https://apps.worldagroforestry.org/treesnmarkets/wood/">2012</a>) as well as this repository using the DOI.</p>
BROT Database: Plant trait data for Mediterranean Basin species: BROT: plant trait database for Mediterranean Basin species (BROT 2013.06)
The plant trait database for Mediterranean Basin species (BROT) is available as a published version (BROT version 2008.11) which corresponds to the original database finalized in November 2008 and published in Ecology 90 (2009). Reference: Paula S, Arianoutsou M, Kazanis D, Tavsanoglu Ç, Lloret F, Buhk C, Ojeda F, Luna B, Moreno JM, Rodrigo A, Espelta JM, Palacio S, Fernández-Santos B, Fernandes PM, and Pausas JG. 2009. Fire-related traits for plant species of the Mediterranean Basin. Ecology 90: 1420. The data imported to EOL are based on the online version which is an extended (more data and more traits) and updated version of the original one. Note that the use of this online version requires to quote both the original (published) and the online version. Reference: Paula S. & Pausas J.G. 2013. BROT: a plant trait database for Mediterranean Basin species. Version 2013.06. URL: <p></p>http://www.uv.es/jgpausas/brot.htm<p></p>Based on Paula S. & Pausas J.G. 2013. BROT: a plant trait database for Mediterranean Basin species. Version 2013.06. URL: <p></p>http://www.uv.es/jgpausas/brot.htm
Parasitic Plants Database
Jan Schlauer, Willem Meijer, Rick Walker. 2019. The Parasitic Plant Database. <p></p>http://www.omnisterra.com/bot/pp_home.cgi. Accessed on 2019-10-06<p></p>
Carnivorous Plants Database
Jan Schlauer, Rick Walker. 2019. The Carnivorous Plant Database. <p></p>http://www.omnisterra.com/bot/cp_home.cgi. Accessed on 2019-10-06<p></p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.