Find research datasets worth reusing

FIGURE 5 in Morphological and molecular systematic investigation of Laurencia karachiana sp. nov. (Ceramiales, Rhodophyta) from Karachi, Pakistan

FIGURE 5. Laurencia karachiana Bibi, Cassano & Rasheed sp. nov. (A) Transverse section of upper portion of branch showing an axial cell (arrow) with four pericentral cells (p). (B) Detail of medullary cell with lenticular thickening (arrow). (C) Male branches. (D) Detail of compound-cymose male branches. (E) Longitudinal section through a male branchlet showing spermatangial branches in cup-shaped tips. (F) Detail of of trichoblast-type spermatangial branches with two laterals, sterile (arrow) and spermatangial branches. (G) Detail of spermatangial branches with terminal vesicular sterile cells (arrow) and spermatangia with an apical nucleus. Scale bar: A and B, F and G, 25 μm; C, 2 mm; D, 1 mm; E, 100 μm.

FIGURE 3 in Morphological and molecular systematic investigation of Laurencia karachiana sp. nov. (Ceramiales, Rhodophyta) from Karachi, Pakistan

FIGURE 3. Neighbor-joining (NJ) analysis for COI-5P sequences. Bootstrap values for NJ (2000 replicates) are shown at nodes, values under 70 were not considered. Sequence generated in this study in bold.

FIGURE 2 in Morphological and molecular systematic investigation of Laurencia karachiana sp. nov. (Ceramiales, Rhodophyta) from Karachi, Pakistan

FIGURE 2. Consensus tree derived from Maximum likelihood (ML) analyses of rbcL sequences. Bootstrap supports for NJ (2000 replicates)/ML (1000 replicates)/PP <0.95 are given at the nodes. Sequence generated in this study in bold; – indicates lack of bootstrap support or values under 70; *indicates full support.

FIGURE 1 in Morphological and molecular systematic investigation of Laurencia karachiana sp. nov. (Ceramiales, Rhodophyta) from Karachi, Pakistan

FIGURE 1. Map of Karachi coast showing sampling sites. Site 1. French Beach (Station/Ledge 1), Site 2. French Beach (Station/Ledge 2), Site 3. Hawke's Bay.

opennotspecifiedDec 2023View details →

Table 1 in Molecular phylogeny and comparative morphology reveal the species validity and systematic position of Lepidodesma (Bivalvia: Unionidae)

Table 1 Historical classification systems of the genus Lepidodesma in Unionidae<table><tbody><tr><th>Author</th><th>Subfamily</th><th>Tribe</th></tr></tbody><tbody><tr><th>Heude (1874)</th><td>Unioninae</td><td>–</td></tr><tr><th>Simpson (1896)</th><td>Unioninae</td><td>–</td></tr><tr><th>Hass (1969)</th><td>Anodontinae</td><td>–</td></tr><tr><th>Liu (1979)</th><td>Anodontinae</td><td>–</td></tr><tr><th>Prozorova et al. (2005)</th><td>Anodontinae</td><td>–</td></tr><tr><th>Huang et al. (2002)</th><td>Unioninae</td><td>–</td></tr><tr><th>Graf and Cummings (2007)</th><td>Unioninae</td><td>Unionini</td></tr><tr><th>Zhou et al. (2016)</th><td>Unioninae</td><td>–</td></tr><tr><th>Huang et al. (2019)</th><td>Unioninae</td><td>Lepidodesmini</td></tr><tr><th>Lopes-Lima et al. (2020)</th><td>Unioninae</td><td>Lepidodesmini</td></tr><tr><th>Graf and Cummings (2021)</th><td>Unioninae</td><td>Unionini</td></tr><tr><th>In this study</th><td>Unioninae</td><td>Lepidodesmini</td></tr></tbody></table>

opennotspecifiedDec 2023View details →

Table 3 in Molecular phylogeny and comparative morphology reveal the species validity and systematic position of Lepidodesma (Bivalvia: Unionidae)

Table 3 Three-gene sequences used for species evolutionary analysis and corresponding GenBank numbers<table><tbody><tr><th>Taxa</th><th>COI</th><th>16S rRNA</th><th>28S rRNA</th></tr><tr><th>Unionidae Rafinesque, 1820</th></tr><tr><th>Unioninae Rafinesque, 1820</th></tr><tr><th>Anodontini Rafinesque, 1820</th></tr></tbody><tbody><tr><th>Pyganodon grandis (Say, 1829)</th><td>AF231734</td><td>NC_013661</td><td>AF305384</td></tr><tr><th>Strophitus undulatus (Say, 1817)</th><td>AF156505</td><td>AY238491</td><td>DQ191415</td></tr><tr><th>Platynaias compressa (Lea, 1829)</th><td>AF156503</td><td>NC_015481</td><td>DQ191414</td></tr><tr><th>Anodonta anatina (Linnaeus, 1758)</th><td>KX822632</td><td>NC_022803</td><td>KX822588</td></tr><tr><th>Anodonta cygnea (Linnaeus, 1758)</th><td>KX822633</td><td>JQ253863</td><td>KX822589</td></tr><tr><th>Pseudanodonta complanata (Rossmässler, 1835)</th><td>KX822661</td><td>JQ253868</td><td>KX822617</td></tr><tr><th>Cristariini Lopes-Lima, Bogan & Froufe, 2017 in Lopes-Lima et al., 2017a</th></tr><tr><th>Sinanodonta woodiana (Lea, 1834)</th><td>HQ283346</td><td>HQ283346</td><td>MG595604</td></tr><tr><th>Sinanodonta tumens (Haas, 1910)</th><td>LC519024</td><td>LC224015</td><td>LC519081</td></tr><tr><th>Cristaria plicata (Leach, 1814)</th><td>NC_012716</td><td>NC_012716</td><td>MG595484</td></tr><tr><th>Anemina arcaeformis (Heude, 1877)</th><td>NC_026674</td><td>NC_026674</td><td>MG595457</td></tr><tr><th>Lepidodesmini Huang et Wu, 2019 in Huang et al., 2019</th></tr><tr><th>Lepidodesma languilati (Heude, 1874) SU 106</th><td>MG463016</td><td>AF389411</td><td>MG595543</td></tr><tr><th>Lepidodesma languilati (Heude, 1874) SU 107</th><td>MG463015</td><td>AF389411</td><td>MG595544</td></tr><tr><th>Lepidodesma languilati (Heude, 1874) SU 108</th><td>MG463017</td><td>AF389411</td><td>MG595545</td></tr><tr><th>Lepidodesma languilati (Heude, 1874) 1 a</th><td>OQ880586</td><td>OQ881064</td><td>OQ881058</td></tr><tr><th>Lepidodesma languilati (Heude, 1874) 2 a</th><td>OQ880587</td><td>OQ881065</td><td>OQ881059</td></tr><tr><th>Lepidodesma languilati (Heude, 1874) 3 a</th><td>OQ880588</td><td>OQ881066</td><td>OQ881060</td></tr><tr><th>Lepidodesma aligera (Heude, 1877) 1 a</th><td>OQ908914</td><td>OQ892281</td><td>OQ892278</td></tr><tr><th>Lepidodesma aligera (Heude, 1877) 2 a</th><td>OQ908915</td><td>OQ892282</td><td>OQ892279</td></tr><tr><th>Ambleminae Rafinesque, 1820</th></tr><tr><th>Lampsilini Ihering, 1901</th></tr><tr><th>Potamilus alatus (Say, 1817)</th><td>KP795037</td><td>KU559011</td><td>KP795019</td></tr><tr><th>Lampsilis cardium Rafinesque, 1820</th><td>AF120653</td><td>KX713226</td><td>AF305386</td></tr><tr><th>Obliquaria reflexa Rafinesque, 1820</th><td>GU085300</td><td>AY655055</td><td>AF400689</td></tr><tr><th>Truncilla truncata Rafinesque, 1820</th><td>AF156513</td><td>AY655080</td><td>DQ191419</td></tr><tr><th>Pleurobemini Hannibal, 1912</th></tr><tr><th>Elliptio complanata (Lightfoot, 1786)</th><td>EU448173</td><td>DQ094144</td><td>JF899181</td></tr><tr><th>Quadrulini Ihering, 1901</th></tr><tr><th>Quadrula quadrula (Rafinesque, 1820)</th><td>AF156511</td><td>NC_013658</td><td>DQ191417</td></tr><tr><th>Margaritiferidae Henderson, 1929</th></tr><tr><th>Margaritifera margaritifera (Linnaeus, 1758)</th><td>KX550089</td><td>KX550091</td><td>KX550093</td></tr><tr><th>Margaritifera dahurica (Middendorff, 1850)</th><td>KJ161516</td><td>KJ943526</td><td>KT343747</td></tr></tbody></table>aThe sequence from this study

opennotspecifiedDec 2023View details →

Fig. 3 in Molecular phylogeny and comparative morphology reveal the species validity and systematic position of Lepidodesma (Bivalvia: Unionidae)

Fig. 3 Schematic drawing for gene arrangement and structure characteristics of Lepidodesma aligera and Lepidodesma languilati. Protein-coding and tRNA genes are colored to show the difference and commonness of codon (and anti-codon) usage. Arabic numerals in the figure represent the length (bp) of the corresponding gene. Abbreviation of 22 tRNAs: H, tRNAHis; A, tRNAAla; S2, tRNASer2; S1,tRNA Ser1; E, tRNAGlu; M, tRNAMet; W, tRNATrp; R, tRNAArg; K,tRNA Lys; T, tRNAThr; Y, tRNATyr; L1, tRNALeu1; N, tRNAAsn; P,tRNA Pro; F, tRNAPhe; Q, tRNAGln; C, tRNACys; I, tRNAIle; V, tRNA Val; L2, tRNALeu2; G, tRNAGly; D, tRNAAsp

dryad32/100

Data from: Phylogenetic systematics of Cochlospermaceae (Malvales) based on molecular and morphological evidence

Cochlospermaceae (Malvales) is a small family of two genera, Amoreuxia and Cochlospermum. Cochlospermum has a pantropical distribution with species present in Mexico, Central and South America, the West Indies, Africa, India, Southeast Asia, and northern Australia, whereas Amoreuxia has a more restricted distribution in the Americas. Amoreuxia is comprised of four herbaceous species, and Cochlospermum has seven tree species and five that are suffrutescent subshrubs. The two genera also differ in floral symmetry, corolla coloration patterns, and stamen morphology. The goals of this study were to reconstruct the phylogeny of Cochlospermaceae to evaluate the monophyly of the family and its two genera, to resolve interspecific relationships, and to interpret patterns of morphological evolution. In addition, a minor goal was to examine its relationship to sister families, such as Bixaceae, a family in which Cochlospermaceae has been variously placed. Phylogenetic analyses were carried out using DNA sequences of the following markers: nuclear ribosomal ITS and the chloroplast trnG and trnL-F regions. The data support the monophyly of Cochlospermaceae and its distinctiveness from its sister families. While Amoreuxia is supported as monophyletic, Cochlospermum is paraphyletic with two species (C. orinocense and C. tetraporum) consistently placed outside a clade of all remaining Cochlospermum species. Ancestral character state reconstructions of morphology indicate that the tree habit may be ancestral in Cochlospermaceae with a single shift to an herbaceous growth form in Amoreuxia with the suffrutescent growth form having arisen twice within Cochlospermum, once in South America and once in Africa. There has been a single shift in floral morphology from radial symmetry, solid yellow petals, and uniform stamens to bilateral symmetry, two-toned petals, and dimorphic stamens in Amoreuxia. Anthers with one apical pore found in core Cochlospermum species may be a reduction from anthers with two pores, such as those found in Amoreuxia and in C. orinocense and C. tetraporum. Seed shape supports the sister relationships within Cochlospermaceae, particularly within Amoreuxia.

opencc-zeroDec 2016View details →

opennotspecifiedJun 2007View details →

FIGURE 1 in Molecular systematics of Malagasy poison frogs in the Mantella betsileo and M. laevigata species groups

FIGURE 1. Localities of the collected samples included in the molecular analyses of the Mantella betsileo and Mantella laevigata groups.

opennotspecifiedJun 2007View details →

FIGURE 2. Phylogram from a Maximum Parsimony analysis, representing a 50 in Molecular systematics of Malagasy poison frogs in the Mantella betsileo and M. laevigata species groups

FIGURE 2. Phylogram from a Maximum Parsimony analysis, representing a 50% majority-rule consensus tree of 65700 equally most parsimonious trees. Mantella bernhardi was defined as outgroup. Specimens with identical haplotypes were merged; numbers in brackets after names of taxa give the number of specimens with the same haplotype. Numbers at nodes are bootstrap values in percent from a Maximum Parsimony bootstrap analysis with 250 replicates. Asterisks denote posterior probabilities from a partitioned Bayesian analysis: (*)>90%; *>95%; **>99%.

PLATE 2 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 2. Serrasalmus manueli (10) and S. gouldingi (11–15). (Photographs of S. gouldingi specimens 12 and 14 by Donald Taphorn.)

FIGURE 7 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 7. Phylogenetic trees of serrasalmids inferred from ribosomal (A) and control region (B) data sets, both including original material and GenBank sequences. Parsimony bootstrap percentages are shown above branch nodes, while proportions (>50%) of trees possessing a given clade in Bayesian posterior distributions are shown below. Taxa shared by both trees are in bold font. Specimen sequences from original material appear in shadow boxes, preceding numbers (1-33) correspond to numbered specimens and information presented in Table 1 and elsewhere. GenBank sequences are followed by gb. Taxa with VNTR in control region marked by an "R" and reconstruction of presence of VNTR shown in blue. GenBank (gb) species with asterisk (*) indicate taxa of which we question the identification.

FIGURE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 6. Primers used for amplifying and sequencing the control region and adjacent tRNAs. Internal primers 5'-3': 662F – ACCATGCCAAGGCGTTCTTT, 662R – AAAGAACGCCTTGGCATGGT, 724F – ACATTTGGTCACTTTCG- GAGA, 462R – CGGTTGGTGGTCTCTTACTACA, F-TTF2 – CGCCACCAGAAAAGAGAGAT, and F-12R2 - GCCCGTGGAACTTTCTAGG

PLATE 5 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 5. Serrasalmus irritans (24), Pygocentrus cariba (25), and Pygopristis denticulatus (27). (No photograph or voucher available for specimen 26.)

FIGURE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 1. Alternative hypotheses of serrasalmid relationships: (A) Machado-Allison (1983, 1985), based on morphology, divides family into two major clades; (B) Machado-Allison et al. (1989) revised piranha clade showing the position of Pristobrycon striolatus if absence of pre-anal spine is considered to be primitive character (arrow indicates occurrence of this trait); (C) Ortí et al. (1996), based on mitochondrial ribosomal RNA sequence data, defines three major clades. Upper tree includes 13 of the currently 15 recognized genera, lower tree includes 11 genera. Note: the genus Tometes was presented in original tree of Ortí et al. (1996) as "N. gen. A" (P. Petry, pers. comm. 2005). The authors also stated that specimens assigned by Machado-Allison (1982, 1983) to Utiaritichthys do not belong to that genus, apparently suggesting the specimens are Tometes.

PLATE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 6. Pristobrycon striolatus (28–31) and additional small juvenile specimens collected with genetic vouchers showing life colors.

FIGURE 3 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 3. Diet and intestinal length data mapped onto Machado-Allison's (1985) proposed phylogeny (modified from Nico 1991). Diet data based on 18 serrasalmid species from the Orinoco River basin (Venezuela); number in parentheses following generic name represents numbers of species in each genus included in study; Jv = juvenile trait; ad = adult trait; long intestine defined as mean intestine length>1.2 X standard length.

PLATE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 1. Serrasalmus manueli (1–9). (No photograph or voucher available for specimen 3.) (Photograph of 8-S. manueli by Frank Pezold.)

FIGURE 5 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 5. Adult and juvenile specimens of Serrasalmus gouldingi (A and B) and S. manueli (C and D) from southern Venezuela. Adult specimens (upper frame) are 195 and 240 mm SL; juvenile specimens (lower frame) are both 65 mm SL. Museum catalogue numbers for A-D: UF 148231, UF 120211, UF 121513, and UF 81180.

FIGURE 2 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 2. Van Every and Kritsky (1992) hypothesis of the evolutionary relationships of 10 piranha species from the central Amazon based on their helminth (Anacanthorus) parasite fauna.