Find research datasets worth reusing

Data From: Evolution of woody plants to the land‐sea interface: The atypical genomic features of mangroves with atypical phenotypic adaptation

How plants adapt and diverge in extreme environments is a key question of plant evolution and ecology. Mangrove invasion of intertidal environments is facilitated by adaptive phenotypes such as aerial roots, salt-secreting leaf, and viviparity, and genomic mechanisms including whole genome duplication and transposable element number reduction. However, a number of mangroves lack these typical phenotypes. The question we ask is whether these phenotypically atypical mangroves also have distinct genomic features? The sibling mangrove species Lumnitzera littorea and Lumnitzera racemosa provide a model to study this question. We sequenced and assembled their genomes to chromosome level, together with a closely related species Combretum micranthum. While most mangroves have small genomes, the genomes of both Lumnitzera species are large (1443 and 1317 Mb) and carry a high proportion of repeat sequences (~75%). Moreover, Lumnitzera species have not undergone post-gamma whole-genome duplications. Their genome size increased mainly due to the expansion of repeat sequences in their ancestors. However, Lumnitzera genomes have reduced transposable elements by constraining the proliferation of new LTR-RTs. Meanwhile, the two species have more gene families contracted than expanded, and some gene families with reversed size change may underlie their differentiation in root morphology and local distribution. We identified 86 chromosomal inversions, five of which are measured between 6.5 and 12.8 megabases. A number of genes located in these inversions function in pigment biosynthesis, a process likely involved in flower color differentiation between the Lumnitzera species. We conclude that the mangroves with atypical phenotypes also have atypical genomic evolution.

Phenotypic plasticity contributes more to the variations in nutrient resorption than genetic differentiation in a grassland dominant

1. Phenotypic plasticity and genetic differentiation are the two important processes determining the leaf nutrient resorption among and within plant species, which is critical for understanding the adaptability of plants. However, relative contributions of these two processes have never been quantified at a large geographical scale. 2. Here, we investigated intraspecific variations in nutrient resorption among 14 Stipa breviflora populations along a latitude gradient in 2018 and 2019. Furthermore, we sow seeds from these populations in two common gardens at different latitudes, and examined the variations in nutrient resorption. 3. Our results showed that nitrogen and phosphorus resorption efficiency (NRE and PRE) among S. breviflora populations in nature were positively related to latitude, while this trend disappeared in the common gardens. The heritability of NRE and PRE was 11.45 % and 16.78 %, respectively. These results suggested that phenotypic plasticity contributed much more than genetic variation to nutrient resorption of S. breviflora. Moreover, the structural equation modeling (SEM) suggested that latitude indirectly affected nutrient resorption mainly by altering soil nutrients. With the increasing of latitude, soil nutrients decreased while nutrient resorption increased. This suggested <a name="_Hlk78556987"></a>the main process regulating nutrient resorption is negative feedback to soil nutrient availability. 4. Our study provides new insights into the role of nutrient resorption in plant adaptations to geographic variations.

Effects of semi-constant temperature on embryonic and hatchling phenotypes of six-tubercled Amazon River turtles, Podocnemis sextuberculata

Purpose: We evaluated how constant incubation temperatures affect life-history traits pre-hatching and post-hatching of the six-tubercled Amazon River turtle, Podocnemis sextuberculata. Methods: We incubated eggs from natural nests at ten semi-constant temperatures between 22.26±1.01°C and 37.37±0.38°C (2013) and at six temperatures between 25.75±0.22°C and 36.17±0.15°C (2016). In 2013, we raised hatchling for 90 days to evaluate effects of temperature on early hatchling growth. We evaluated maternal effects in 2016. Results: P. sextuberculata displays temperature-dependent sex determination and produces males at colder and females at warmer temperatures (TSD Ia). The estimated pivotal temperature was 33.73 ± 0.15°C and the transitional range of temperatures (TRT) 1.16 ± 0.59°C. Semi-constant temperatures below 26°C and above 38°C were lethal. Intermediate temperatures (32.25°C and 31.5°C, respectively) were optimal for hatching success and produced larger hatchlings that grew slower early in life compared to colder or warmer conditions, which produced smaller hatchlings. Warmer incubation temperatures within the optimal range (28°C-37°C) accelerated embryonic development. In contrast, comparisons of 30, 60 and 90 days-old suggests that warmer incubation temperatures reduced growth and mass gain rates post-hatching, such that incubation temperature effects on body size at emergence disappeared by 3 months of age. Conclusions: Six-tubercled Amazon River turtles showed the highest pivotal temperature reported for any turtle. The relatively narrow TRT may limit the evolutionary potential of this vulnerable turtle in the face of global warming. Future incubation experiments at a finer scale (33°C-36°C) are warranted to refine the sex-ratio reaction norm. Field studies that monitor natural nests are imperative to evaluate conservation measures and the effect of female-biased illegal hunting and climate change. By providing data about the thermal biology of an understudied lineage of non-model species, our study helps fill gaps in our understanding of the evolution of vertebrate sex determination and its potential adaptive value.

Data from: Genetic architecture of repeated phenotypic divergence in Littorina saxatilis ecotype evolution

Chromosomal inversions have been shown to play a major role in local adaptation by suppressing recombination between alternative arrangements and maintaining beneficial allele combinations. However, so far, their importance relative to the remaining genome remains largely unknown. Understanding the genetic architecture of adaptation requires better estimates of how loci of different effect sizes contribute to phenotypic variation. Here, we used three Swedish islands where the marine snail Littorina saxatilis has repeatedly evolved into two distinct ecotypes along a habitat transition. We estimated the contribution of inversion polymorphisms to phenotypic divergence while controlling for polygenic effects in the remaining genome using a quantitative genetics framework. We confirmed the importance of inversions but showed that contributions of loci outside inversions are of similar magnitude, with variable proportions dependent on the trait and the population. Some inversions showed consistent effects across all sites, whereas others exhibited site-specific effects, indicating that the genomic basis for replicated phenotypic divergence is only partly shared. The contributions of sexual dimorphism as well as environmental factors to phenotypic variation were significant but minor compared to inversions and polygenic background. Overall, this integrated approach provides insight into the multiple mechanisms contributing to parallel phenotypic divergence.

opencc-zeroAug 2022View details →

Phenotypic changes of beak dimensions in urban birds of Switzerland

Humans' large influence on the environment has constructed many new ecological niches, such as in urban areas. Phenotypic changes, including morphological ones related to human influence are known from a small number of bird species. The amount of change in a given time period, i.e., the rate of change, may vary. Rates of change (both evolutionary and through phenotypic plasticity) are reportedly rapid in human-influenced settings, although this is disputed. We present new data on changes in beak dimensions and rates of change over historical time periods in four urban bird species (Common Chaffinch, European Greenfinch, Eurasian Blackbird, House Sparrow) from three Swiss cities (Basel, Bern, Geneva). Our study shows that beak dimensions have changed little in most investigated urban bird populations over the past century. Only in Genevan Blackbirds there was evidence for an increase in beak length over the past 65 years; Bernese Chaffinches appear to be trending toward a decrease in beak width over the past 55 years. Rates of change in our sample in comparison with literature records showed that compared to populations less influenced by humans, urban evolutionary rates appear to be similar. Although in accordance with previous findings about other urban bird species, our study exemplifies the difficulty to find universal patterns in tempo and mode of phenotypic evolution in urban areas, even when considering the same taxa. Our data contribute to the expanding field of urban evolutionary biology, which is particularly important regarding the growing urban habitats worldwide.

opencc-by-4.0Apr 2022View details →

Structural variants in the barley gene pool: precision and sensitivity to detect them using short-read sequencing and their association with gene expression and phenotypic variation

SNV of 23 parental barley inbreds of the double round robin population (DRR) (<a href="https://doi.org/10.1111/pbi.13746">https://doi.org/10.1111/pbi.13746</a>) used in the publication "Structural variants in the barley gene pool: precision and sensitivity to detect them using short-read sequencing and their association with gene expression and phenotypic variation". SV, INDELs, and additional data are available via figshare (https://doi.org/10.6084/m9.figshare.16802473).

opencc-zeroAug 2022View details →

Spatial phylogenetic and phenotypic patterns reveal ontogenetic shifts in ecological processes of plant community assembly

The analysis of spatial phylogenetic and phenotypic structure of plant communities provides insight into the underlying processes and interactions governing their assembly, and how these may change during plant ontogeny. We used point pattern analysis to find out if saplings and adult plants are surrounded by phylogenetically and phenotypically more similar or dissimilar neighbours than expected by chance, and whether these associations change from the sapling to the adult stage. To this end, we combined information on the phylogenetic structure and eight phenotypic traits of 15 woody plant species in two Mediterranean mixed forests of southeastern Spain. At the community level, we found that the sapling bank at both sites did not show phylogenetic or phenotypic spatial patterns, but adults showed phylogenetic clustering (i.e., heterospecific neighbours were more similar than expected). At the species level, we found frequently repulsive patterns in the sapling bank of less abundant species (i.e., heterospecific sapling or adult neighbours were more dissimilar than expected) in both, phylogenetic and phenotypic analyses. For the adult stage, we found phylogenetic attraction (i.e., more similar neighbours) in just one species and phenotypic clustering in four species. The processes driving the assembly of the communities of saplings and adults leave detectable signals in the spatial phylogenetic and phenotypic structure of our two forest communities. Our findings reinforce the existence of ontogenetic shifts in the mechanisms involved in plant community assembly. Facilitation between phylogenetically distant and phenotypically divergent species favours the recruitment of less abundant species. However, processes acting later in the ontogeny ameliorate the competition between close relatives and determine the spatial structure of adult plants. Nevertheless, the role of phenotype in shaping adult-adult interactions was context- and trait-dependent. The use of spatial point pattern analysis allowed a nuanced interpretation of the phylogenetic and phenotypic structures of the plant community.

Depicting the phenotypic space of the annual plant Diplotaxis acris in hyper-arid deserts

The phenotypic space encompasses the assemblage of trait combinations yielding well-suited integrated phenotypes. At the population level, understanding phenotypic space structure requires the quantification of among- and within-population variation in traits and the correlation pattern among them. Here, we studied the phenotypic space of the annual plant Diplotaxis acris occurring in hyper-arid deserts. Given the advance of warming and aridity in vast regions occupied by drylands, D. acris can indicate the successful evolutionary trajectory that many other annual plant species may follow in expanding drylands. To this end, we conducted a greenhouse experiment with 176 D. acris individuals from five Saudi populations to quantify the genetic component of variation in architectural and life-history traits. We found low among-population divergence but high among-individual variation in all traits. In addition, all traits showed a high degree of genetic determination in our study experimental conditions. We did not find significant effects of recruitment and fecundity on fitness. Finally, all architectural traits exhibited a strong correlation pattern among them, whereas for life-history traits, only higher seed germination implied earlier flowering. Seed weight appeared to be an important trait in D. acris, as individuals with heavier seeds tended to advance flowering and have a more vigorous branching pattern, which led to higher fecundity. Population divergence in D. acris might be constrained by the severity of the hyper-arid environment, but populations maintain high among-individual genetic variation in all traits. Furthermore, D. acris showed phenotypic integration for architectural traits and, to a lesser extent, for life-history traits. Overall, we hypothesize that D. acris may be fine-tuned to its demanding extreme environments. Evolutionary speaking, annual plants facing increasing warming, aridity and environmental seasonality might modify their phenotypic spaces towards new phenotypic configurations strongly dominated by correlated architectural traits enhancing fecundity and seed-related traits advancing flowering time.

opencc-zeroAug 2022View details →

Stay in shape: assessing the adaptive potential of shell morphology and its sensitivity to temperature in the invasive New Zealand Mud Snail Potamopyrgus antipodarum through phenotypic plasticity and natural selection in Europe

Climate change may force organisms to adapt genetically or plastically to new environmental conditions. Invasive species show a remarkable potential for rapid adaptation. The ovoviviparous New Zealand mud snail (NZMS), Potamopyrgus antipodarum, has successfully established across Europe with two clonally reproducing mitochondrial lineages since its arrival in the first half of the 19th century. Its remarkable variation in shell morphology was shown to be fitness relevant. We investigated the effects of temperature on shell morphology across eleven populations from Germany and the Iberian Peninsula in a common garden across three temperatures. We analysed size and shape using geometric morphometrics. For both, we compared reaction norms and estimated heritabilities. For size, the interaction of temperature and haplotype explained about 50% of the total variance. We also observed more genotype by environment interactions indicating a higher degree of population differentiation than in shape. Across the three temperatures, size followed the expectations of the temperature-size rule, with individuals growing larger in cold environments. Changes in shape may have compensated changes in size affecting space for brooding embryos. Heritability estimates were relatively high. As indicated by the very low coefficients of variation for clonal repeatability (CVA), they can probably not be compared in absolute terms. However, they showed some sensitivity to temperature, in haplotype t more so than in z, which was only found in Portugal. The low CVA-values indicate that genetic variation among European populations is still restricted with low potential to react to selection. A considerable fraction of the genetic variation was due to differences between the clonal lineages. The NZMS has apparently not been long enough in Europe to accumulate significant genetic variation relevant for morphological adaptation. As temperature is obviously not the sole factor influencing shell morphology, their interaction will probably not be a factor limiting population persistence under a warming climate in Europe.

opencc-by-4.0Sep 2022View details →

E. coli-ΦX174 genotype to phenotype map reveals flexibility and diversity in LPS structures

Here are the raw sequencing data of all E. coli C and ΦX174 strains obtained during this study. A short description of each file's content can be found below.   Bacteria <ul> <li>"E.coliC_res.zip": Whole genome sequencing results of E. coli C WT and ΦX174-resistant strains (generated by fluctuation experiments). All E. coli C samples were prepared for whole-genome sequencing from one millilitre of stationary-phase cultures. Genomic DNA was extracted using the Wizard® Genomic DNA purification Kit (Promega, Germany). Bacterial samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany) using an Illumina Nextera DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</li> </ul>   <ul> <li>"E.coliC_res_excluded.zip": Whole genome sequencing results of the four ΦX174-resistant E. coli C strains (generated by fluctuation experiments) that have been excluded from the analyses: E. coli C R1, R3, R15, and R19. We found that both E. coli C R3 and R15 were not isogenic. While whole-genome sequencing from their respective glycerol stocks showed only a single mutation in galE, whole-genome sequencing carried on colony re-streaks showed that additional mutations were systematically associated with the single mutation in galE (see file "E.coliC_res_excluded_10_clones). E. coli C R1 displayed an unstable resistant phenotype. Finally, E. coli C R19 was partially resistant to ΦX174 WT. It carries a single mutation in the yajC gene, which encodes for a periplasmic protein. No apparent link to the LPS biosynthesis or assembly has been discovered yet, but yajC might play a role in phage DNA injection into the bacterium’s cytoplasmic membrane.</li> </ul>   <ul> <li>"E.coliC_res_excluded_10_clones.zip": Whole genome sequencing results of 10 randomly chosen isolates of E. coli C R1, R3, and R15.</li> </ul>   <ul> <li>"EcoliC.gb": E. coli C WT strain used as reference.</li> </ul>   Bacteriophages   <ul> <li>“PhiX174_PCR_399r_400f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul>   PhiX174_399_r: CTTGACTCATGATTTCTTACC PhiX174_400_f: TTACTGAACAATCCGTACGTTTC   DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads.   <ul> <li>“PhiX174_PCR_2361r_2362f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul>   PhiX174_2361_r: TCGCTTGGTCAACCCCTCAG PhiX174_2362_f: AGCGCGGTAGGTTTTCTGCT   DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads. <ul> <li>“PhiX174_excluded.zip”: Since we removed R19 from the final analysis, we also removed its corresponding evolved phage obtained during the first evolution experiment (ΦX174 R19 T1). We also removed the phage infecting R5 (ΦX174 R5 T2) because it was not isogenic (confirmed by Sanger Sequencing).</li> </ul> <ul> <li>“PhiX174_Sequencing_Sanger.zip”: Both F and H genes were amplified by performing 35 cycles of PCR using Phusion® High-Fidelity PCR Master Mix with HF Buffer. The sequencing primers are listed in the Information_Sanger_Samples_ID.xlsx file.</li> </ul>   <ul> <li>“PhiX174_ref.gb”: PhiX174 WT strain used as reference.</li> </ul>   We also include the raw data and pictures from our spotting tests and plaque assays used to complete the final matrix of infection. <ul> <li>Spotting_tests_reanalyzed.xlsx”: Raw data from the pictures (see Photos_matrices.zip) used to generate the Hierarchical agglomerative clustering analysis of the host ranges of evolved phage and Infection matrix of evolved ΦX174 phages on the 31 resistant E. coli C strains.</li> </ul> The Photos_matrices.zip folder contains   <ul> <li>“SSA_matrix_Bact_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted phages on bacterial lawns.</li> </ul>   <ul> <li>“SSA_matrix_Phi_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted bacteria on phage lawns.</li> </ul>   <ul> <li>“Mismatches”: We performed plaque assays when combinations of phages and bacteria showed discrepancies between the two spotting test methods</li> </ul>   <ul> <li>“Plaque_assays_R12_R14”: pictures of plaque assays where we tested the sensitivity of E. coli C R12 and R14 toward a subset of evolved phages</li> </ul>   <ul> <li>“Plaque_assays_of_PhiX174R22T1c1/R28T1c1_vs_WT”: pictures of plaque assays where we tested the sensitivity of E. coli C WT toward phages infecting R22 and R28.</li> </ul>   <ul> <li>“displayImage.R”. Script made to look for the desired combination of phage and bacterium.</li> </ul>   Finally, we include the raw OD measurments:   <ul> <li>“All_EcoliC_growth_raw_data.xlsx”: raw OD measurements of each E. coli C resistant strains used in this study.</li> </ul>

opencc-zeroSep 2022View details →

The diverse effects of phenotypic dominance on hybrid fitness

When divergent populations interbreed, their alleles are brought together in hybrids. In the initial F1 cross, most divergent loci are heterozygous. Therefore, F1 fitness can be influenced by dominance effects that could not have been selected to function well together. We present a systematic study of these F1 dominance effects by introducing variable phenotypic dominance into Fisher's geometric model. We show that dominance often reduces hybrid fitness, which can generate optimal outbreeding followed by a steady decline in F1 fitness, as is often observed. We also show that "lucky" beneficial effects sometimes arise by chance, which might be important when hybrids can access novel environments. We then show that dominance can lead to violations of Haldane's Rule (reduced fitness of the heterogametic F1) but strengthens Darwin's Corollary (F1 fitness differences between cross directions). Taken together, results show that the effects of dominance on hybrid fitness can be surprisingly difficult to isolate because they often resemble the effects of uniparental inheritance or expression. Nevertheless, we identify a pattern of environment-dependent heterosis that only dominance can explain, and for which there is some suggestive evidence. Our results also show how existing data set upper bounds on the size of dominance effects. These bounds could explain why additive models often provide good predictions for later-generation recombinant hybrids, even when dominance qualitatively changes outcomes for the F1.

opencc-zeroSep 2022View details →

Scale-dependent environmental effects on phenotypic distributions in Heliconius butterflies

Examining how environmental factors influence phenotypic distribution might provide valuable information about local adaptation, divergence, and speciation. The red-yellow Müllerian mimicry ring of Heliconius butterflies displays a wide range of color patterns across the Neotropics and is involved in several hybrid zones, making it an excellent system to study color phenotypic distribution. Using a multiscale distribution strategy, we studied whether different phenotypes of the distantly related species H. erato and H. melpomene, belonging to the red-yellow mimetic ring, are associated with different environmental conditions. We show that environmental gradients (particularly heat and precipitation factors) drive Heliconius phenotypic distributions, but that phenotype and environmental correlations vary with spatial scale. While co-mimics are frequently found in similar environments at a broad scale, patterns at the local level are not necessarily consistent (different variables are the best predictors of phenotypic occurrence in different areas) or congruent (co-mimic pairs show distinct associations with the environment). Thus, large-scale analysis may help to identify how environmental heterogeneity influences broad mimic phenotypic distributions, but local studies are needed to understand the context-dependent biotic, abiotic, and historical mechanisms that drive finer-scale phenotypic shifts.

opencc-zeroSep 2022View details →

Molecular phenotyping uncovers differences in basic housekeeping functions among closely related species of hares (Lepus spp., Lagomorpha: Leporidae)

Speciation is a fundamental evolutionary process, which results in genetic differentiation of populations and manifests as discrete morphological, physiological as well as behavioral differences. Each species has had its own evolutionary trajectory, formed by many types of selection pressures and random drift, making it extremely complicated to associate genetic differences between the species with the phenotypic differences. In the present study, we have used an in vitro model to analyze in depth the genetic and gene regulation differences between fibroblasts of two closely related mammals, arctic/subarctic mountain hare (Lepus timidus Linnaeus) and a temperate, steppe-like climate adapted brown hare (Lepus europaeus Pallas). We discovered the existence of a species-specific expression pattern of 1,623 genes, manifesting in differences in cell growth, respiration, and metabolism. Interspecific differences in the housekeeping functions of fibroblast cells suggest speciation acts on fundamental processes, even in these two interfertile species. Our results help to understand the molecular constituents of a species difference on a cellular level, which could contribute to the maintenance of the species boundary.

Ecological determinants of variation in phenotypic selection on quantitative immune defence traits

Immune defence is an important determinant of organismal fitness. While theoretical models based on trade-offs in resource allocation predict quantitative immune traits to be subject to stabilizing selection due to associated energetic costs and self-harm, empirical studies report mainly positive directional selection. This discrepancy may arise from multiple ecological factors that vary in nature and could influence selection. We examined if selection on immune activity varies depending on immune challenge/infection risk, between immune traits, and among populations in the freshwater snail Lymnaea stagnalis. We assessed selection on the phenoloxidase-like and antibacterial activity of snail haemolymph while manipulating the level of immune challenge imposed by environmental microbes. We did this using snails from multiple populations and also quantified within-population family-level variation (i.e., evolutionary potential) in the snails' immune activity. We found that the strength of immune challenge and the examined immune trait determined selection on the snails' immune function. Thus, variation in infection risk can be an important factor in maintaining genetic variation in defence traits. Additionally, immune traits showed low among-population differentiation but high within-population genetic variation. This pattern could arise if natural snail populations are exposed to higher temporal than spatial variation in infection risk.

opencc-by-nc-4.0Feb 2022View details →

Figure 3 in Deciphering the chemical phenotype in Atta laevigata (Smith, 1858) (Hymenoptera: Formicidae): A relationship between polymorphism and cuticular hydrocarbons

Figure 3. Similarity dendrogram based on the similarities and dissimilarities of the cuticular chemical compositions of the subcastes of the ant Atta laevigata based on the data obtained by CG-MS.Cophenetic Correlation Coefficient = 0.76.

opencc-by-nc-4.0Feb 2022View details →

Figure 1 in Deciphering the chemical phenotype in Atta laevigata (Smith, 1858) (Hymenoptera: Formicidae): A relationship between polymorphism and cuticular hydrocarbons

Figure 1. Percentage abundance (a) and Number of peaks (b) grouped in the different classes of cuticular hydrocarbons of subcastes of workers of Atta laevigata.

opencc-by-4.0Oct 2022View details →

VCF and phenotypes of 314 sweetpotato

This dataset is consists of two parts, one is derived from the SNP calling from 314 sweetpotato germplasm resources, and the  reference genome was a set of subgenomes of "Xushu18"; and another is the phenotypes of these germplasm resources. The related article is "Resequencing of sweetpotato germplasm resources reveals key loci associated with multiple agronomic traits".

Adaptive effects of parental and developmental environments on offspring survival, growth, and phenotype

Phenotypic adjustments to environmental variation are particularly relevant to cope with putative environmental mismatches often imposed by natal dispersal. We used an inter-generational cross-transplant field-based experiment to evaluate the morphological and physiological effects of parental and post-settlement water flow environments on the orange-fin anemonefish Amphiprion chrysopterus through ontogeny (at pre- and post-settlement stages). Offspring born from parents under high water flow had an 18% higher caudal fin aspect ratio (a compound measure of shape) at the pre-settlement stage, 10% slower growth after settlement, and 55% lower survival after settlement compared to offspring from low-water-flow parents. At the pre-settlement stage, caudal fin length was determined by parental caudal fin length. At the post-settlement stage, fish survived equally well with similar phenotypes in both high- and low-developmental-flow environments. However, results suggest potential developmental phenotypic plasticity in caudal fin length, which increases more under low water flow during development. After settlement growth was the only morphological or physiological trait that was associated with parental water flow, which was lower from parents under high flow, as was survival. These results give important insights into the parental contribution, both genetic and non-genetic, in determining early offspring phenotype and subsequent growth and survival. Our results also suggest that offspring may possess the flexibility to cope with a wide range of local environments including those different from their parents. Overall, the findings of this study show the fitness consequences of living in different environments and the likely trade-offs between parental and offspring fitness in a wild population.

Data from: Common protein-coding variants and the racing phenotype in galloping racehorse breeds

Centuries-long selection for system-wide morphological, physiological, and metabolic adaptations has led to extreme athletic phenotypes among geographically diverse horse breeds. Here, we identify genes contributing to exercise adaptation in racehorses by applying genomics approaches for racing performance, an end-point athletic phenotype. Using an integrative genomics strategy to first combine population genomics results with skeletal muscle exercise and training transcriptomic data, followed by whole-genome resequencing of Asian horses, we identify protein-coding variants in genes of interest in galloping racehorse breeds (Arabian, Mongolian and Thoroughbred). A core set of genes, G6PC2, HDAC9, KTN1, MYLK2, NTM, SLC16A1 and SYNDIG1, with central roles in muscle, metabolism, and neurobiology, are key drivers of the racing phenotype. Although racing potential is a multifactorial trait, the genomic architecture shaping the common athletic phenotype in horse populations bred for racing provides evidence for the influence of protein-coding variants in fundamental exercise-relevant genes. Variation in these genes may therefore be exploited for genetic improvement of horse populations towards specific types of racing.

Phenotypic convergence in a natural Daphnia population acclimated to low temperature

Fluidity of a given membrane decreases at lower ambient temperatures, whereas it rises at increasing temperatures, which is achieved through changes in membrane lipid composition. In consistence with homeoviscous adaptation theory, lower temperatures result in increased tissue concentrations of polyunsaturated fatty acids (PUFAs) in D. magna, suggesting a higher PUFA requirement at lower temperatures. However, so far homeoviscous adaptation has been suggested for single or geographically separated Daphnia genotypes only. Here we investigated changes in relative fatty acid (FA) tissue concentrations in response to a lower temperature (15°C) within a D. magna population. We determined juvenile growth rates (JGR) and FA patterns of 14 genotypes, that were grown on Chlamydomonas klinobasis at 15°C and 20°C. We report significant differences of JGR and the relative body content of various FAs between genotypes at either temperature and between temperatures. Based on slopes of reaction norms, we found genotype-specific changes in FA profiles between temperatures suggesting that genotypes have different strategies to cope with changing temperatures. In a hierarchical clustering analysis we grouped genotypes according to differences in direction and magnitude of changes in relative FA content, which resulted in three clusters of genotypes following different patterns of changes in FA composition. These patterns suggest a lower importance of the PUFA eicosapentaenoic acid (EPA, C20:5ω3) than previously assumed. We calculated an unsaturation index (UI) as a proxy for membrane fluidity at 15°C, and we neither found significant differences for this UI nor for fitness, measured as JGR, between the three genotype clusters. We conclude that these three genotype clusters represent different physiological solutions to temperature changes by altering the relative share of different FAs, but that their phenotypes converge with respect to membrane fluidity and JGR. These clusters will be subjected to different degrees of PUFA-limitation when sharing the same diet.