Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
457
datasets available to search
ShareScore release 0.9.0
Dataset results
457 results for “Cave 4”
Text-fig. 4. Hindlimb bones of Panthera fossilis (REICHENAU, 1906) from Za Hájovnou Cave (Moravia, the Czech Republic), Middle Pleistocene. a – left patella (Narozeninová chodba, layer 5,> MIS 9), anterior view; b – fragment of left fibula (Narozeninová chodba, layer 5,> MIS 9), anterior view; c – right calcaneus (Narozeninová chodba, layer 5,> MIS 9), dorsal view; d – right astragalus (Chodba naděje, layer 4, ≤ MIS 9), distal end view; e – left Mt IV (Narozeninová chodba, layer 5,> MIS 9), medial view; f – proximal phalanx of the first digit (Narozeninová chodba, layer 5,> MIS 9), dorsal view; g – proximal phalanx with gnaw marks (Narozeninová chodba, layer 5,> MIS 9), plantar view. in Panthera Fossilis (Reichenau, 1906) (Felidae, Carnivora) From Za Hájovnou Cave (Moravia, The Czech Republic): A Fossil Record From 1987-2007
Text-fig. 4. Hindlimb bones of Panthera fossilis (REICHENAU, 1906) from Za Hájovnou Cave (Moravia, the Czech Republic), Middle Pleistocene. a – left patella (Narozeninová chodba, layer 5,> MIS 9), anterior view; b – fragment of left fibula (Narozeninová chodba, layer 5,> MIS 9), anterior view; c – right calcaneus (Narozeninová chodba, layer 5,> MIS 9), dorsal view; d – right astragalus (Chodba naděje, layer 4, ≤ MIS 9), distal end view; e – left Mt IV (Narozeninová chodba, layer 5,> MIS 9), medial view; f – proximal phalanx of the first digit (Narozeninová chodba, layer 5,> MIS 9), dorsal view; g – proximal phalanx with gnaw marks (Narozeninová chodba, layer 5,> MIS 9), plantar view.
Text-fig. 2. Thin section of canine from a bear (Ursus deningeri), Chodba naděje, layer 4, depth 140–200 cm. in Seasonality Of Use Of Za Hájovnou Cave By Bears And Lions
Text-fig. 2. Thin section of canine from a bear (Ursus deningeri), Chodba naděje, layer 4, depth 140–200 cm.
Text-fig. 4. Taphonomic and pathological phenomena of bear bones from Middle Pleistocene deposits from Spojovací chodba – Narozeninová chodba in Za Hájovnou Cave (Moravia, the Czech Republic). a – Mc V sin. with a pathological phenomenon on the metapodial distal part (tuberosity/exostosis?); b – gnawed juvenile ulna; c – right tibia gnawed by a large rodent (porcupine?) with detail. in Basic Population And Taphonomic Analysis Of Bear Assemblages From Za Hájovnou Cave (Moravia, The Czech Republic): A Fossil Record From 1987-2007
Text-fig. 4. Taphonomic and pathological phenomena of bear bones from Middle Pleistocene deposits from Spojovací chodba – Narozeninová chodba in Za Hájovnou Cave (Moravia, the Czech Republic). a – Mc V sin. with a pathological phenomenon on the metapodial distal part (tuberosity/exostosis?); b – gnawed juvenile ulna; c – right tibia gnawed by a large rodent (porcupine?) with detail.
Text-fig. 3. Cave deposits exposed in Section No. 2 and recorded paleomagnetic polarities. 1 – reworked deposits; 2 – clayey silt, light brown with abundant black dots, structureless; 3 – clayey silt to silty clay, brown, chaotically deposited; 4 – clayey silt, light brown, structureless; 5 – clayey silt, light brown, laminated; 6 – clayey silt to silty clay, brown, structureless; 7 – clayey silt to silty clay, light brown, structureless; 8 – clayey silt, brown with abundant white carbonate clasts; 9 – clayey sandy silt, brown with abundant lighter clayey fragments; 10 – clayey sandy silt, brown with sporadic lighter clayey fragments. Geomagnetic polarity scale: black (N) – normal polarities, white (R) – reversed polarities, grey – intermediate or uninterpretable polarities. For more details see text. in New Updated Results Of Paleomagnetic Dating Of Cave Deposits Exposed In Za Hájovnou Cave, Javoříčko Karst
Text-fig. 3. Cave deposits exposed in Section No. 2 and recorded paleomagnetic polarities. 1 – reworked deposits; 2 – clayey silt, light brown with abundant black dots, structureless; 3 – clayey silt to silty clay, brown, chaotically deposited; 4 – clayey silt, light brown, structureless; 5 – clayey silt, light brown, laminated; 6 – clayey silt to silty clay, brown, structureless; 7 – clayey silt to silty clay, light brown, structureless; 8 – clayey silt, brown with abundant white carbonate clasts; 9 – clayey sandy silt, brown with abundant lighter clayey fragments; 10 – clayey sandy silt, brown with sporadic lighter clayey fragments. Geomagnetic polarity scale: black (N) – normal polarities, white (R) – reversed polarities, grey – intermediate or uninterpretable polarities. For more details see text.
Figure. Distribution of Neomys teres and Neomys anomalus species in Turkey (square = Neomys anomalus, triangle = Neomys teres). 1: Ulubey (Ordu), 2: Meryemana (Trabzon), 3: Kutul (Artvin), 4: Yalnızçam (Kars), 5: Bendimahi Canyon (Muradiye, Van), 6: Seyfe (Amasya), 7: Safranbolu (Karabük), 8: Topçam (Ordu), 9: Tamdere (Giresun), 10: Çamlık (Rize), 11: Ovid Mountain (Rize), 12: Lake Abant (Bolu), 13: Kayseri, 14: Erzurum, 15: Samsun, 16: Belgrad Forest (İstanbul), 17: Lake Abant (Bolu), 18: İrve creek (İstanbul), 19: Erçek Mountain (Van), 20: Paşaalandere (Tekirdağ), 21: Lake Terkos (İstanbul), 22: Yeşiloba (Adana), 23: Yenice, Çayır (Zonguldak), 24: Abant (Bolu), 25: Hanyatak village (Sakarya), 26: Longoz forest, Dupnisa cave, Demirköy (Kırklareli), 27: Lake Eber (Afyon), 28: Çırpılar (Çanakkale), 29: Uludağ (Bursa), 30: Balkusan (Karaman). in Taxonomic status of Neomys species (Mammalia: Soricomorpha) and their distribution in Turkey
Figure. Distribution of Neomys teres and Neomys anomalus species in Turkey (square = Neomys anomalus, triangle = Neomys teres). 1: Ulubey (Ordu), 2: Meryemana (Trabzon), 3: Kutul (Artvin), 4: Yalnızçam (Kars), 5: Bendimahi Canyon (Muradiye, Van), 6: Seyfe (Amasya), 7: Safranbolu (Karabük), 8: Topçam (Ordu), 9: Tamdere (Giresun), 10: Çamlık (Rize), 11: Ovid Mountain (Rize), 12: Lake Abant (Bolu), 13: Kayseri, 14: Erzurum, 15: Samsun, 16: Belgrad Forest (İstanbul), 17: Lake Abant (Bolu), 18: İrve creek (İstanbul), 19: Erçek Mountain (Van), 20: Paşaalandere (Tekirdağ), 21: Lake Terkos (İstanbul), 22: Yeşiloba (Adana), 23: Yenice, Çayır (Zonguldak), 24: Abant (Bolu), 25: Hanyatak village (Sakarya), 26: Longoz forest, Dupnisa cave, Demirköy (Kırklareli), 27: Lake Eber (Afyon), 28: Çırpılar (Çanakkale), 29: Uludağ (Bursa), 30: Balkusan (Karaman).
Fig. 4 in Three new species of day geckos (Reptilia: Gekkonidae: Cnemaspis Strauch, 1887) from isolated granite cave habitats in Sri Lanka
Fig. 4. Holotype male of Cnemaspis kotagamai sp. nov. (NMSL 2018.07.01) in life in-situ in Bambaragala. (A) Dorsal view of the full body, and (B) ventral view with scattered yellow coloration. Photos: Suranjan Karunarathna.
Fig. 4 in Fossil population structure and mortality analysis of the cave bears from Urşilor Cave, north-western Romania
Fig. 4.Transverse diameters of all of the adult lower (A, N = 74) and upper (B, N = 105) cave bear canines from Urşilor (~45–40 calendar kyrs BP).
FIGURE 4 in Four new species of the spider genus Pinelema (Araneae, Telemidae) from caves in South China
FIGURE 4. Pinelema curcici sp. nov., male holotype (A, C, D) and female paratype (B, E). A. Chelicera, posterior view; B. Epigynum, ventral view; C. Embolus tip, apical view; D. Colulus, ventral view; E. Spermatheca, dorsal view. Scale bars: A, D 0.10 mm; B, C, E 0.05 mm.
FIGURE 4 in Imaging of the inner structure of cave bear teeth by novel non-destructive techniques
FIGURE 4. Specimen GS 26-1. 4.1. Volume rendering of the 3D µ-CT. The red area marks the region scanned by OCT. 4.2. Sectional view of 3D OCT data. Quicktime format video file of animated OCT scan. 4.3. µ-CT axial crosssectional scans and 4.4. µ-CT en-face scan. Quicktime format video file of animated µ-CT scan.
FIGURE 4 in Large mammals (carnivores, artiodactyls) from Solna Jama Cave (Bystrzyckie Mts, Southwestern Poland) in the context of faunal changes in the postglacial period of Central Europe
FIGURE 4. Gulo gulo cranium from Solna Jama Cave (JSJ/Gg/1-1) in dorsal view (left) compared with a cranium from a large modern male from Scandinavia (right) from collection of Natural History Museum University of Wrocław (coll. no. M/500328). Scale bar equals 10 mm.
Figure 4 in Phototrophic communities of Ahshtyrskaya Cave in the condition of artificial light
Figure 4. Scatter plots of 18 sites based on: a) total species composition, b) higher plants species composition, c) algae and cyanobacteria species composition; d) cluster analysis for 18 sites based on total species composition of communities in different cave zones.
FIG. 4 in Two new species of Collembola (Hexapoda) from Saliente Cave (Almería, Spain)
FIG. 4. — Pygmarrhopalites crepidinis Jordana & Baquero, n. sp. A, Ant. II; B, Ant. III; C, Ant. IV basal subsegment; D, Ant. IV distal four subsegments; E, subcoxae, coxa, trochanter and femur of leg 1, posterior view; F, tibiotarsus and claw of leg 1, posterior view; G, subcoxae, coxa, trochanter and femur of leg 2, anterior view; H, tibiotarsus and claw of leg 2, anterior view; I, subcoxae, coxa, trochanter and femur of leg 3, anterior view; J, tibiotarsus and claw of leg 3, anterior view; K, dens and mucro; a, b, c and d spines variations. Scale bars: 50 μm.
FIG. 4 in Centropages orsinii Giesbrecht, 1889 (Copepoda, Calanoida, Centropagidae) from an anchialine cave in Vanuatu
FIG. 4. — Centropages orsinii Giesbrecht,1889 adult male: A, leg 1, anterior; B, leg 3, anterior;C, endopod of leg 2, anterior.Scale bars:100 μm.
FIG. 4. — Log10 in Felidae from Cooper's Cave, South Africa (Mammalia: Carnivora)
FIG. 4. — Log10 total length of P4 plotted against metastyle length of the P4 for six African Dinofelis Zdansky, 1924 species. Data from Werdelin & Lewis (2001), Lacruz et al. (2006) and this study.
Figures 4–7 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)
Figures 4–7. Bollmania beroni sp. n., male. (4) Head, anterior pleurotergites and gonopod, lateral view. (5) Head, frontal view. (6) Telson, postero-lateral view. (7) Leg-pair 7, posterior view.
Figure 4 in New genera of Bogidiellidae (Amphipoda: Gammaridea) from SW Pacific and Mediterranean marine caves
Figure 4. Fidelidiella pectinata gen. et sp. nov. (A–E) Holotype; (F) paratype. (A) Urosome, lateral; (B) left first pleopod, anterior; (C) right first uropod, posterior; (D) left second uropod, posterior; (E) telson, posterior (5dorsal); (F) urosome, lateral.
Fig. 4 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 4. Tachycines (Gymnaeta) papilious sp. nov. A–F. Holotype, ♂ (HBU). A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view.
Fig. 4 in Cave Shrimps Of The Genus Edoneus Holthuis, 1978, From Luzon, The Philippines, With Descriptions Of Three New Species (Crustacea: Decapoda: Atyidae)
Fig. 4. Edoneus sketi, new species: A, cephalothorax and cephalic appendages, lateral view; B, telson; C, distal portion of telson; D, preanal carina; E, scaphocerite; F, mandible; G, maxillula; H, maxilla; I, first maxilliped; J, second maxilliped; K, third maxilliped. Scale bars: A = 1 mm; B, K, E = 0.5 mm; C = 0.1 mm; D, F–J = 0.3 mm. (male, cl 4.1 mm, paratype, ZRC).
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Fig. 4 in A new species of the genus Arachnothelphusa Ng, 1991 (Crustacea: Decapoda: Gecarcinucidae) from a limestone cave in Sarawak (Malaysian Borneo)
Fig. 4. Carapace morphology of Arachnothelphusa species. A, A. sarang, new species, holotype male (20.4 × 14.7 mm) (ZRC 2020.0098), limestone cave, Bukit Sarang, Bintulu, Sarawak; B, A. merarapensis Grinang, Pui & Ng, 2015, holotype male (22.5 × 16.8 mm) (ZRC 2016.0297), Merarap Hot Spring, Lawas, Sarawak; C, A. terrapes Ng, 1991, male (30.8 × 20.5 mm) (ZRC 2017.1205), Danum Valley, Lahad Datu, Sabah; D, A. kadamaiana (Borradaile, 1900), male (20.1 × 14.9 mm) (SMF 4282), Kadamian River, Sabah; E, A. melanippe (De Man, 1899), paratype female (21.4 × 16.7 mm) (RMNH D1303b), Mt. Liang Koebeng, Kalimantan, Indonesia. E after Ng (1991).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.