Find research datasets worth reusing

Fig. 7 in A new genus and two new species of cave-dwelling cyclopoids (Crustacea, Copepoda) from the epikarst zone of Thailand and up-to-date keys to genera and subgenera of the Bryocyclops and Microcyclops groups

Fig. 7. Metacyclops thailandicus sp. nov., holotype, ♀. A. Antennule. B. Antenna. C. Mandible. D. Maxillule. E. Maxilla. F. Maxilliped. Scale bars: 100 μm.

Fig. 4 in A new genus and two new species of cave-dwelling cyclopoids (Crustacea, Copepoda) from the epikarst zone of Thailand and up-to-date keys to genera and subgenera of the Bryocyclops and Microcyclops groups

Fig. 4. Siamcyclops cavernicolus gen. et sp. nov., allotype, ♂. A. Habitus, dorsal view. B. Urosome, ventral view. C. Urosome, lateral view. D. Urosome, dorsal view. E. Antennule. Scale bars: 100 μm.

Fig. 3 in A new genus and two new species of cave-dwelling cyclopoids (Crustacea, Copepoda) from the epikarst zone of Thailand and up-to-date keys to genera and subgenera of the Bryocyclops and Microcyclops groups

Fig. 3. Siamcyclops cavernicolus gen. et sp. nov., holotype, ♀. A. P1. B. P2. C. P3. D. P4. Scale bar: 100 μm.

Fig. 1 in A new genus and two new species of cave-dwelling cyclopoids (Crustacea, Copepoda) from the epikarst zone of Thailand and up-to-date keys to genera and subgenera of the Bryocyclops and Microcyclops groups

Fig. 1. Siamcyclops cavernicolus gen. et sp. nov., holotype, ♀. A. Habitus, with spermatophores and egg sac, dorsal view. B. Urosome, ventral view. C. Urosome, dorsal view. D. Urosome, lateral view. E. Antennule. F. P5, ventral view. G. P5, lateral view. Scale bars: 100 μm.

Fig. 2 in A new genus and two new species of cave-dwelling cyclopoids (Crustacea, Copepoda) from the epikarst zone of Thailand and up-to-date keys to genera and subgenera of the Bryocyclops and Microcyclops groups

Fig. 2. Siamcyclops cavernicolus gen. et sp. nov., holotype, ♀. A. Antenna. B–C. Mandible. D. Maxillule. E. Maxilla. F. Maxilliped. G. Genital double-somite with spermatophore, ventral view. H. Genital double-somite with spermatophore, lateral view. Scale bars: 100 μm.

Fig. 6 in A new genus and two new species of cave-dwelling cyclopoids (Crustacea, Copepoda) from the epikarst zone of Thailand and up-to-date keys to genera and subgenera of the Bryocyclops and Microcyclops groups

Fig. 6. Metacyclops thailandicus sp. nov., holotype, ♀. A. Habitus, with egg sac, dorsal view. B. Urosome, dorsal view. C. Urosome, lateral view. D. Urosome, ventral view. E. P5, lateral view. F. P5, ventral view. Scale bars: 100 μm.

Figure 6 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China

Figure 6. Bisetocreagris gracilenta Gao & Zhang, sp. nov., female holotype: a. carapace (dorsal view); b. left chelicerae (dorsal view); c. rallum; d. galea (dorsal view); e. left palp (minus chela, dorsal view); f. left chela (dorsal view); g. genital (ventral view); h. chelal fingers (retrolateral view); i. leg I (lateral view); j. tarsus of leg IV (lateral view); k. subterminal setae; l. leg IV (lateral view). Scale bars: 1.00 mm (a, b, e, f, h–j, l); 0.25 mm (c, d, g).

Figure 3 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China

Figure 3. Bisetocreagris guangshanensis Gao & Zhang, sp. nov., male holotype: a. carapace (dorsal view); b. left chelicerae (dorsal view); c. rallum; d. galea (dorsal view); e. left palp (minus chela, dorsal view); f. left chela (retrolateral view); g. genital (ventral view); h. chelal fingers (dorsal view); i. leg I (lateral view); j. subterminal setae; k. leg IV (lateral view). Scale bars: 0.10 mm (c, d, g); 0.50 mm (a, b, e, f, h, i, k).

Figure 2 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China

Figure 2. Bisetocreagris guangshanensis Gao & Zhang, sp. nov., male holotype: a. carapace (dorsal view); b. pedipalp (lateral view); c. rallum; d. pedipalpal femur; e. pedipalpal femur (female); f. chelal fingers (retrolateral view); g. leg I (lateral view); h. leg IV (lateral view); i. tarsus of leg IV (lateral view). Scale bars: 0.50 mm (a–h); 0.20 mm (j).

Figure 1 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China

Figure 1. Bisetocreagris guangshanensis Gao & Zhang, sp. nov., a. male holotype, dorsal view; b. female paratype, dorsal view.

Figure 5 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China

Figure 5. Bisetocreagris gracilenta Gao & Zhang, sp. nov., female holotype: a. carapace (dorsal view); b. chelicerae (dorsal view); c. rallum; d. pedipalp (lateral view); e. leg I (lateral view); f. leg IV (lateral view); g. pedipalpal coxae (ventral view); h. left chela (retrolateral view). Scale bars: 0.1 mm (c); 0.5 mm (b); 1.00 mm (a, d–f, h).

opencc-by-4.0Jul 2016View details →

Figures 9–16 - Neobisium curcici n in On the biodiversity of pseudoscorpions in Croatia: Neobisium curcici (Pseudoscorpiones: Neobisiidae), a new cave-dwelling species from Dalmatia (Croatia)

Figures 9–16 - Neobisium curcici n. sp., paratype tritonymph from the Jama pod Gažnovcem Pit, Stilja, near Vrgorac, Dalmatia, Croatia: 9 – carapace; 10 – epistome; 11 – chelicera; 12 – sternites II-IV; 13 – flagellum; 14 – pedipalp; 15 – pedipalpal chela; 16 – leg IV. Scale = 0.50 mm (Figs. 9, 14–16) and 0.25 mm (Figs. 10–13).

Figure 2 in Duvalius bozidari, a new cave-dwelling species of trechine ground beetles (Coleoptera: Carabidae: Trechinae) from western Serbia

Figure 2. The distribution of Duvalius (Neoduvalius) bozidari sp. n. (black circles) and D. (N.) guidononveilleri Janák & Moravec, 2008 (black star) in Serbia.

Figure 1 in Duvalius bozidari, a new cave-dwelling species of trechine ground beetles (Coleoptera: Carabidae: Trechinae) from western Serbia

Figure 1. Duvalius (Neoduvalius) bozidari sp. n. from the Jovanjska Pećina Cave, village of Jovanje, near Valjevo, western Serbia: a - holotype male, habitus (dorsal view); b - holotype male, aedeagus (lateral view); c - holotype male, aedeagus (dorsal view); d - holotype male, abdominal sternite IX (urite); e - paratype female, genitalia. Scales = 2.00 mm (a) and 0.20 mm (b–e).

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.