Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
79
datasets available to search
ShareScore release 0.9.0
Dataset results
79 results for “plant database”
Gene/Protein BridgeDb ID Mapping Database (Ensembl Plants 52)
<p>Mapping databases derived from Ensembl Plants 52. These files can be used with BridgeDb.<br> This version doesn't have the issue of not could be searched using gene names (e.g. in PathVisio).</p> <p>The scripts which were used to create these databases based on Ensembl BioMart can be found at <a href="https://github.com/bridgedb/create-bridgedb-genedb">https://github.com/bridgedb/create-bridgedb-genedb</a>.</p>
FLAMITS: FLAMmability plant traiTS database
Open the record for dataset details and reuse information.
Constructing a database of alien plants in the Himalayas to test patterns structuring diversity
Open the record for dataset details and reuse information.
Database of plant-flower visitor interactions from Ireland
Open the record for dataset details and reuse information.
Data from: MycoDB, a global database of plant response to mycorrhizal fungi
Plants form belowground associations with mycorrhizal fungi in one of the most common symbioses on Earth. However, few large-scale generalizations exist for the structure and function of mycorrhizal symbioses, as the nature of this relationship varies from mutualistic to parasitic and is largely context-dependent. We announce the public release of MycoDB, a database of 4,010 studies (from 438 unique publications) to aid in multi-factor meta-analyses elucidating the ecological and evolutionary context in which mycorrhizal fungi alter plant productivity. Over 10 years with nearly 80 collaborators, we compiled data on the response of plant biomass to mycorrhizal fungal inoculation, including meta-analysis metrics and 24 additional explanatory variables that describe the biotic and abiotic context of each study. We also include phylogenetic trees for all plants and fungi in the database. To our knowledge, MycoDB is the largest ecological meta-analysis database. We aim to share these data to highlight significant gaps in mycorrhizal research and encourage synthesis to explore the ecological and evolutionary generalities that govern mycorrhizal functioning in ecosystems.
Database for meta-analysis of herbivore impacts on plant-soil feedbacks
<p class="MsoNormal"><span>We conducted a meta-analysis to test for an interaction between plant-soil feedbacks and herbivory, including effects on the magnitude and direction of feedbacks, herbivore consumption and herbivore growth.</span></p> <p class="MsoNormal"><em><span> </span></em><span>We identified 197 studies to address herbivore impacts on plant-soil feedbacks and 189 studies to address plant-soil impacts on herbivores. We calculated Hedge's D values to assess three questions: 1) What is the plant-soil feedback value of plants exposed to herbivory or no herbivory? 2) What is the growth or biomass of herbivores feeding on plants exposed to home or away soils in plant-soil feedback studies? 3) How much plant tissue is consumed by herbivores on plants grown in home or away soils?</span></p> <p class="paragraph"><em> </em></p> <p class="paragraph"><span class="normaltextrun">We found an overall significant weak negative effect of herbivory on plant-soil feedbacks that varied by plant functional type. In legumes herbivory drove plant-soil feedbacks from positive to negative, but herbivory on forbs further decreased </span><span class="eop">negative feedbacks</span><span class="normaltextrun">.</span><span class="eop"> </span><span class="normaltextrun"> Herbivore consumption was generally greater on plants grown in away soils. However, herbivore consumption was greater in home soils conditioned by legumes but lower in home soils conditioned by forbs.</span></p> <p class="paragraph"><em> </em></p> <p class="paragraph"><span class="eop">Therefore plant functional type determines the impact of conditioned soil on feedbacks, and herbivore consumption explains these results for legumes but not forbs. </span></p>
Database of the list for associations between host plants and fruit flies
<p><span><span><span><span><span><span><span><span><span><span><span>Insects tend to feed on related hosts. Coevolution tends to be dominated by interactions resulting from plant chemistry in defense strategies, and evolution of secondary metabolisms being in response to insect herbivory remains a classic explanation of coevolution. The present study examines whether evolutionary constraints existing in host associations of economically important fruit flies in the species-rich tribe Dacini (Diptera: Tephritidae) and to what extent these species have evolved specialized dietary patterns. We found a strong effect of host phylogeny on associations on the 37 fruit flies tested, although the fruit fly species feeding on ripe commercially grown fruits that lost the toxic compounds after long domestication are mostly polyphagous. We assessed the phylogenetic signal of host breadth across the fruit fly species, showing that the results were substantially different depending on partition levels. Further, we mapped main host family associations onto the fruit fly phylogeny and Cucurbitaceae has been inferred as the most likely ancestral host family for Dacini based on ancestral state reconstruction.</span></span></span></span></span></span></span></span></span></span></span></p>
A database of Defra statutory biodiversity metric unit values for terrestrial habitat samples across England, with plant, butterfly and bird species data
<p>Policies requiring biodiversity no net loss or net gain as an outcome of environmental planning have become more prominent worldwide, catalysing interest in biodiversity offsetting as a mechanism to compensate for development impacts on nature. Offsets rely on credible and evidence-based methods to quantify biodiversity losses and gains. Following the introduction<span> of the United Kingdom's Environment Act in November 2021, all new developments requiring planning permission in England are expected to demonstrate a 10% biodiversity net gain from 2024, calculated using the statutory biodiversity metric framework (Defra, 2023). </span><span>The metric is used to calculate both baseline and proposed post-development biodiversity units, and is </span>set to play an increasingly prominent role in nature conservation nationwide.<span> </span><span>The metric has so far </span>received limited scientific scrutiny.</p> <p><span>This dataset comprises a database of statutory biodiversity metric unit values for terrestrial habitat samples across England. For each habitat sample, we present </span><span>biodiversity units alongside five long-established single-attribute proxies for biodiversity (</span><span>species richness, individual abundance, number of threatened species, mean species range or population, mean species range or population change)</span><span>. </span><span>Data were compiled </span><span>for species from three taxa (vascular plants, butterflies, birds), from sites across England. The dataset includes 24 sites within </span>grassland, wetland, woodland and forest, sparsely vegetated land, cropland, heathland and shrub, i.e. <span>all terrestrial broad habitats except urban and individual trees. Species data were reused from long-term ecological change monitoring datasets</span> (mostly in the public domain), whilst biodiversity units were calculated following field visits. Fieldwork was carried out in April-October 2022 to calculate biodiversity units for the samples. <span>Sites were initially assessed using metric version 3.1, which was current at the time of survey, and were subsequently updated to the statutory metric for analysis using field notes and species data. </span>Species data <span>were derived from </span>24 <span>long-term ecological change monitoring</span> sites across the Environmental Change Network (ECN), Long Term Monitoring Network (LTMN) and Ecological Continuity Trust (ECT), collected between 2010 and 2020.</p>
USDA NRCS PLANTS Database: USDA PLANTS text (37) DwCA
The PLANTS Database provides standardized information about the vascular plants, mosses, liverworts, hornworts, and lichens of the U.S. and its territories. It includes names, plant symbols, checklists, distributional data, species abstracts, characteristics, images, crop information, automated tools, onward Web links, and references. This information primarily promotes land conservation in the United States and its territories, but academic, educational, and general use is encouraged. PLANTS reduces government spending by minimizing duplication and making information exchange possible across agencies and disciplines. Data published on EOL by the PLANTS database include attribute data, images and descriptive text.<p></p>This is primarily a text object resource.
European Plant Translocation Database
Open the record for dataset details and reuse information.
Italian Hydropower Programmable Plants Database
<p>Database of</p> <p> </p> <p>M. Catania<sup>a</sup>, F. Parolin<sup>a</sup>, F. Fattori<sup>b</sup>, and P. Colbertaldo<sup>a</sup></p> <p><sup>a</sup> Department of Energy, Politecnico di Milano – Via Lambruschini, 4A, 20156, Milan, Italy</p> <p><sup>b</sup> Dipartimento di Scienze Teoriche e Applicate, Università degli Studi dell’Insubria – Via O. Rossi, 9, 21100, Varese, Italy</p> <p> </p> <p>This version of the database has been developed for the journal article:</p> <p>M. Catania, F. Parolin, F. Fattori, and P. Colbertaldo, “The role of hydropower in decarbonisation scenarios,” Renew. Energy, vol. 236, no. September, p. 121411, 2024, doi: <a href="https://doi.org/10.1016/j.renene.2024.121411">10.1016/j.renene.2024.121411</a>.</p> <p>The database integrates the existing JRC database (http://data.europa.eu/89h/52b00441-d3e0-44e0-8281-fda86a63546d) to model hydroelectric resources in Italy. The plants included are hydro water reservoirs (HDAM) and hydro pumping storage ones (HPHS). The database relies on open-source information and for each plant includes:</p> <ul> <li>power capacity (for pumping storage plants, both charging and discharging)</li> <li>energy capacity</li> <li>head</li> <li>volume of the basin</li> <li>geographical coordinates</li> <li>sources to check data</li> </ul> <p> One of the main sources is the Ministry of Infrastructure and Transport (MIT) especially for the volume of the basins (https://dgdighe.mit.gov.it/categoria/articolo/_cartografie_e_dati/_cartografie/cartografia_dighe ).</p> <p>a visual representation available at <a href="https://hydropowerdatabaseitaly.github.io/">https://hydropowerdatabaseitaly.github.io/</a>.</p> <p>Data are reconstructed based on publicly accessible information. Authors do not provide any guarantees of the validity or correctness of the data. No responsibility is taken for issues related to the use of such data.</p>
Open Plant Phenotyping Database Seedling Images
<p>The Open Plant Phenotyping Database [OPPD] is a public dataset for visual recognition tasks on images of plant seedlings. The dataset consists of 7,590 images with 315,038 plant objects, representing 64,292 individual plants from 47 different species. Each plant species has been cultivated using three growth conditions (ideal, drought and natural) and tracked temporally to achieve high intra-species variability.</p> <p>This is a subset of the .jpg images available at https://gitlab.au.dk/AUENG-Vision/OPPD/-/archive/master/OPPD-master.zip in the folder: /DATA/images_plants/1COMF/</p>
Datasets for "The Case for Retaining Natural Language Descriptions of Phenotypes in Plant Databases and a Web Application as Proof of Concept", 2023
<p>The collection of a dataset that organized information about plant genes, phenotypes, and annotations from a variety of data sources</p>
CMAUP: a database of collective molecular activities of useful plants
<p><strong>ABSTRACT:</strong></p> <p>Contains information about ingredients, targets, plant-ingredient associations, and ingredient-target associations, along with relevant activity values and references. The dataset has undergone cleaning and preprocessing to ensure data quality and consistency.</p> <p><strong>Instructions:</strong></p> <p>Data were cleaned and duplicates were removed.</p> <p><strong>Inspiration:</strong></p> <p>This dataset uploaded to U-BRITE for "DRG_DEPOT" summer 2023 team project.</p> <p><strong>Acknowledgements:</strong></p> <p>Xian Zeng, Peng Zhang, Yali Wang, Chu Qin, Shangying Chen, Weidong He, Lin Tao, Ying Tan, Dan Gao, Bohua Wang, Zhe Chen, Weiping Chen, Yu Yang Jiang, Yu Zong Chen</p> <p>CMAUP: a database of collective molecular activities of useful plants.<br> <a href="https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gky965/5144144">Nucleic Acids Research</a> 2019; 47(D1): D1118-D1127; PMID: <a href="https://www.ncbi.nlm.nih.gov/pubmed/30357356">30357356</a>; DOI: <a href="https://doi.org/10.1093/nar/gky965">doi.org/10.1093/nar/gky965</a></p> <p><strong>U-BRITE last update data: </strong>06/15/2023</p>
rCRUX Generated rbcl (Plant RBCL7/8) Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: rbcl (Plant RBCL7/8)<br> Gene: rbcl<br> Length of Target: 180<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 150<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA<br> Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC<br> Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Homotypic motifs from 5 databases in the promoters of 21 plant species
<p><strong>What is this about:</strong></p> <p>This project encompasses multiple plant species, primarily employing tools like FIMO and PMET index to search for homotypic motifs in the promoters across various plant species. We selected five different sources of motifs: <strong>CIS-BP2</strong>, <strong>Franco-Zorrilla et al. 2014</strong>, <strong>Jaspar plants non redundant 2022</strong>, <strong>PlantTFDB</strong> and <strong>Plant Cistrome DB</strong>.</p> <p>Our research delves into an extensive analysis of gene expression regulatory elements, aiming to unravel the mechanisms of plant gene expression regulation. For this purpose, we have pre-calculated a vast amount of data in order to identify promoter patterns that consistently appear across different species. These promoter patterns potentially play fundamental and crucial regulatory roles in each species.</p> <p><strong>How to use it:</strong></p> <p>All data are prepared for PMET-Shiny app: <a href="https://github.com/duocang/PMET-Shiny-App">https://github.com/duocang/PMET-Shiny-App</a>.</p> <p>After downloading, all files are unzipped and put in the folder of <em><strong>data/indexing</strong></em> of PMET-Shiny.</p>
Data from: MycoDB, a global database of plant response to mycorrhizal fungi
Open the record for dataset details and reuse information.
Database of the list for associations between host plants and fruit flies
Open the record for dataset details and reuse information.
Data from: High-resolution and large-extent mapping of plant species richness using vegetation-plot databases
Open the record for dataset details and reuse information.
A database of Defra statutory biodiversity metric unit values for terrestrial habitat samples across England, with plant, butterfly and bird species data
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.