Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
4,182
datasets available to search
ShareScore release 0.9.0
Dataset results
4,182 results for “universities”
Future Blood Testing Network+ Overview - Dr Weizi (Vicky) Li (Henley Business School, University of Reading).
<p>This video is the first talk from our two day Future Blood Testing: Challenges & Opportunities Event that took place on the 13/09/2022.</p> <p>Future Blood Testing Network+ Overview - Dr Weizi (Vicky) Li (Henley Business School, University of Reading).</p> <p>Bio: Dr Weizi (Vicky) Li is the PI of the Future Blood Testing Network, an Associate Professor of Informatics and Digital Health, Deputy Director in Informatics Research Centre, Henley Business School, University of Reading. She is an interdisciplinary researcher focusing on using informatics, data science, machine learning, and digital information systems to solve real-world healthcare challenges. She is the academic lead of a large collaborative project of Improving the Quality of Healthcare through an Integrated Clinical Pathway Management Approach and Cloud based Digital Data Integration Platform, which was awarded ESRC O2RB Excellence in Impact Award in 2018 for her research impact on healthcare quality improvement. She is the academic lead of machine learning based decision support system for outpatient management which has successfully been implemented in Royal Berkshire NHS Foundation Trust and has received Research Engagement and Impact award in 2020. She has been PI on projects funded by ESRC, EPSRC, The Health Foundation, NHS and companies, working on data-driven decision support systems that use real-world data (under privacy preserving framework) from multiple sources including Electronic Patient Record in acute, community hospital and primary care settings, remote health monitoring and patient reported outcomes to develop novel technologies (including AI based methods) to support clinical and operational decision makings in patient pathway.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/13-14-09-2022/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/I1xsig9C8w0</p>
Remote blood monitoring for cancer patients- a preliminary landscape analysis - Beth Harvey (University of Reading)
<p>This video is the fifth talk from our two day Future Blood Testing: Challenges & Opportunities Event that took place on the 13/09/2022.</p> <p>Remote blood monitoring for cancer patients- a preliminary landscape analysis - Beth Harvey (University of Reading)</p> <p>Bio: Beth Harvey is currently a master’s student in digital health and data analytics at the Henley Business School. Having completed her bachelor’s in biomedical science, Beth has then gone on to work in the medical device and IVD regulatory sector with a consultancy firm in Vancouver. After moving back to the UK in 2019 Beth worked with multiple UK manufacturers in the digital health space which spurred her interest in the field she is now studying. Beth’s research interests are in healthcare innovation remote patient monitoring, and data analysis. She is currently finishing her dissertation on the opportunities and challenges for remote blood monitoring in oncology in collaboration with the Future Blood Network.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/13-14-09-2022/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/8pbO3N9IQKM</p>
Collaborative Innovation Project funding launch - Dr Samantha Kanza (University of Reading, University of Southampton)
<p>This video is the eighth talk from our two day Future Blood Testing: Challenges & Opportunities Event that took place on the 13/09/2022.</p> <p>Collaborative Innovation Project funding launch - Dr Samantha Kanza (University of Reading)</p> <p>Bio: Dr Samantha Kanza is a Senior Enterprise Fellow at the University of Southampton. She completed her MEng in Computer Science at the University of Southampton and then worked for BAE Systems Applied Intelligence for a year before returning to do an iPhD in Web Science (in Computer Science and Chemistry), which focused on Semantic Tagging of Scientific Documents and Electronic Lab Notebooks. She was awarded her PhD in April 2018. Samantha works in the interdisciplinary research area of applying computer science techniques to the scientific domain, specifically through the use of semantic web technologies and artificial intelligence. Her research includes looking at electronic lab notebooks and smart laboratories, to improve the digitization and knowledge management of the scientific record using semantic web technologies; and using IoT devices in the laboratory. She has also worked on a number of interdisciplinary Semantic Web projects in different domains, including agriculture, chemistry and the social sciences.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/13-14-09-2022/ </p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/PDWZkZBzfqw</p>
Network Theme: The potential of machine learning and AI for blood based investigations - Professor Jeremy Frey (University of Southampton)
<p>This video is the sixth talk from our Future Blood Testing Network Plus Launch that took place on the 23/11/2021.</p> <p>Network Theme: The potential of machine learning and AI for blood based investigations - Professor Jeremy Frey (University of Southampton)</p> <p>Bio: Prof Jeremy Frey Professor of Physical Chemistry, Head of Computational Systems Chemistry, University of Southampton (UoS). He is PI of AI for Scientific Discovery Network+, and co_I on the Internet of Food Things Digital Economy Network+ and has had considerable involvement in the UK e-Science and Digital Economy programmes for many years (e.g., PI of the Digital Economy IT as a Utility Network+. He is a strong proponent of interdisciplinary research and the use of digital technology and ideas to enhance methods of scientific research & development. His own research involves activities across the physical land life sciences, from the application of novel mathematical analysis (e.g., Topological Data Analysis), laser spectroscopy and imagining techniques to chemical and biological problems, with the development of sensors and imagining systems such as the novel soft x-ray microscope. In parallel he works on the integration of these techniques with full provenance environment into laboratory systems using semantic web technologies.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/23-11-21-future-blood-testing-network-launch/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/eNORwfMy5cE</p>
Remote Immune Monitoring: Need, Opportunities and Challenges - Professor Kourosh Saeb-Parsy (University of Cambridge & Cambridge University Hospitals NHS Foundation Trust)
<p>This video is the seventh talk from our Future Blood Testing Network Plus Launch that took place on the 23/11/2021.</p> <p>Remote Immune Monitoring: Need, Opportunities and Challenges - Professor Kourosh Saeb-Parsy (University of Cambridge & Cambridge University Hospitals NHS Foundation Trust)</p> <p>Bio: Professor Kelvin Tsoi is an Epidemiologist specialized in Digital Health. His research interests focus on digital innovation in chronic disease management, including mobile and telecare application for hypertension management, technological implementation and social engagement for cognitive screening, artificial intelligent application on electronic health records. He also works as the traditional epidemiologist on evidence-based medicine and population cohort studies. He obtained his Bachler Degree from Department of Statistics and Doctor of Philosophy from School of Public Health in the Chinese University of Hong Kong. He further received post-doctoral training in the Division of Gastroenterology and Hepatology, Department of Medicine and Therapeutics. He was also appointed as a Director of CUHK JC Bowel Cancer Education Centre to promote colorectal cancer screening. In 2011, he worked as a research scientist in Hospital Authority. He led projects covering a wide range of service areas on chronic diseases, such as service demand projection for schizophrenia and dementia. The experience of database management enhanced his understanding of the HA database structures. In 2013, he was invited to join the interdisciplinary team for Big Data research and worked closely with a team of engineers and data scientists. Currently, Professor Tsoi is an Associate Professor in JC School of Public Health and Primary Care, SH big Data Decision Analytics Research Centre and JC Institute of Ageing. I matriculated as a medical student at Fitzwilliam College in 1993. My interest in biomedical research was developed during my Part II year studying Anatomy A (neurosciences and developmental biology) and I subsequently enrolled on the MB-PhD programme. I completed my doctoral thesis in neurophysiology of circadian rhythms in 2000 and qualified as a medical doctor in 2001. While studying for my PhD, I pursued an active interest in teaching and started supervising undergraduates at Fitzwilliam (and other colleges) in 1998. I served as MCR President in 1999, became a Fellow in 2003 and Director of Studies in Clinical Medicine in 2004. I pursued a career in surgery after graduation and was appointed as a University Lecturer in Transplant Surgery in 2012.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/23-11-21-future-blood-testing-network-launch/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/ANZKGxj87E0</p>
Communicating with the Network & Landscape Workshops - Dr Samantha Kanza (University of Reading, University of Southampton)
<p>This video is the eleventh talk from our Future Blood Testing Network Plus Launch that took place on the 23/11/2021.</p> <p>Communicating with the Network & Landscape Workshops - Dr Samantha Kanza (University of Southampton).</p> <p>Bio: Dr Samantha Kanza is an Enterprise Fellow at the University of Southampton. She completed her MEng in Computer Science at the University of Southampton and then worked for BAE Systems Applied Intelligence for a year before returning to do an iPhD in Web Science (in Computer Science and Chemistry), which focused on Semantic Tagging of Scientific Documents and Electronic Lab Notebooks. She was awarded her PhD in April 2018. Samantha works in the interdisciplinary research area of applying computer science techniques to the scientific domain, specifically through the use of semantic web technologies and artificial intelligence. Her research includes looking at electronic lab notebooks and smart laboratories, to improve the digitization and knowledge management of the scientific record using semantic web technologies; and using IoT devices in the laboratory. She has also worked on a number of interdisciplinary Semantic Web projects in different domains, including agriculture, chemistry and the social sciences.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/23-11-21-future-blood-testing-network-launch/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/fvRb9ULGU2I</p>
The Application of Machine Learning for Classification on Blood Pressure Variability. A New Approach for an Old Idea - Professor Kelvin Tsoi (The Chinese University of Hong Kong, School of Public Health and Primary Care)
<p>This video is the eighth talk from our Future Blood Testing Network Plus Launch that took place on the 23/11/2021.</p> <p>The Application of Machine Learning for Classification on Blood Pressure Variability. A New Approach for an Old Idea - Professor Kelvin Tsoi (The Chinese University of Hong Kong, School of Public Health and Primary Care)</p> <p>Bio: Professor Kelvin Tsoi is an Epidemiologist specialized in Digital Health. His research interests focus on digital innovation in chronic disease management, including mobile and telecare application for hypertension management, technological implementation and social engagement for cognitive screening, artificial intelligent application on electronic health records. He also works as the traditional epidemiologist on evidence-based medicine and population cohort studies. He obtained his Bachler Degree from Department of Statistics and Doctor of Philosophy from School of Public Health in the Chinese University of Hong Kong. He further received post-doctoral training in the Division of Gastroenterology and Hepatology, Department of Medicine and Therapeutics. He was also appointed as a Director of CUHK JC Bowel Cancer Education Centre to promote colorectal cancer screening. In 2011, he worked as a research scientist in Hospital Authority. He led projects covering a wide range of service areas on chronic diseases, such as service demand projection for schizophrenia and dementia. The experience of database management enhanced his understanding of the HA database structures. In 2013, he was invited to join the interdisciplinary team for Big Data research and worked closely with a team of engineers and data scientists. Currently, Professor Tsoi is an Associate Professor in JC School of Public Health and Primary Care, SH big Data Decision Analytics Research Centre and JC Institute of Ageing.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/23-11-21-future-blood-testing-network-launch/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/liLVKA-JHiI</p>
Network Theme: Can blood sampling become a new data source in the role of self-monitoring and self-management of health? - Dr Mark Elliott (University of Warwick)
<p>This video is the fourth talk from our Future Blood Testing Network Plus Launch that took place on the 23/11/2021.</p> <p>Network Theme: Can blood sampling become a new data source in the role of self-monitoring and self-management of health? - Dr Mark Elliott (University of Warwick)</p> <p>Bio: <strong><a href="https://warwick.ac.uk/fac/sci/wmg/people/profile/?wmgid=1147">Dr Mark Elliott</a> </strong>Mark is an Associate Professor at the Institute of Digital Healthcare, WMG, University of Warwick (UoW). Mark’s core research focuses on human movement and physiology analytics. His research uses signal processing and data science approaches to monitor, measure and model human movement and physiology to infer health status. He is the PI of the WMG Motion Capture Laboratory. His work further extends into the broader area of using wearable and on-the- body sensing devices to make objective measures of human behaviour and behaviour change. Much of Dr Elliott’s research is highly applied and involves collaborating with commercial and NHS partners. He has received funding from EPSRC, Innovate UK and SBRI Healthcare, as well as direct industrial funding. He is currently Data Analytics Theme Lead for the EPSRC funded OATech+ Network and on the steering committee for the EPSRC funded VSimulators facilities at Bath and Exeter.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/23-11-21-future-blood-testing-network-launch/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/ChdbggScUgo</p>
Network Introduction - Dr Weizi (Vicky) Li (Henley Business School, University of Reading)
<p>This video is the first talk from our Landscape Report Funding Call Town Meeting that took place on the 03/02/2022.</p> <p>Network Introduction - Dr Weizi (Vicky) Li (Henley Business School, University of Reading).</p> <p>Bio: Dr Weizi (Vicky) Li is the PI of the Future Blood Testing Network, an Associate Professor of Informatics and Digital Health, Deputy Director in Informatics Research Centre, Henley Business School, University of Reading. She is an interdisciplinary researcher focusing on using informatics, data science, machine learning, and digital information systems to solve real-world healthcare challenges. She is the academic lead of a large collaborative project of Improving the Quality of Healthcare through an Integrated Clinical Pathway Management Approach and Cloud based Digital Data Integration Platform, which was awarded ESRC O2RB Excellence in Impact Award in 2018 for her research impact on healthcare quality improvement. She is the academic lead of machine learning based decision support system for outpatient management which has successfully been implemented in Royal Berkshire NHS Foundation Trust and has received Research Engagement and Impact award in 2020. She has been PI on projects funded by ESRC, EPSRC, The Health Foundation, NHS and companies, working on data-driven decision support systems that use real-world data (under privacy preserving framework) from multiple sources including Electronic Patient Record in acute, community hospital and primary care settings, remote health monitoring and patient reported outcomes to develop novel technologies (including AI based methods) to support clinical and operational decision makings in patient pathway.</p> <p>Further details on this event can be found at: https://futurebloodtesting.org/event/03-02-2021-future-blood-testing-network-landscape-report-funding-town-meeting/</p> <p>This video is an output from the Future Blood Testing Network which is funded by EPSRC under Grant Number EP/W000652/1</p> <p>YouTube Link: https://youtu.be/I1xsig9C8w0</p>
Figure 2 in Know your campus: salient research potential of prostigmatic soil mite fauna (Acariformes: Prostigmata, Endeostigmata) within university campus area
Figure 2 Representatives of Prostigmata found in Morasko Campus: A – Cunaxidae:Armascirus bakerilarva; B – Eupodidae:Caleupodes reticulatus adult female; C – Tydeidae:Lorryia reticuloinsigniaadult female; D – Erythraeidae:Abrolophus rudaensislarva; E – Eupalopselli- dae: Eupalopsellus trudisadult female; F – Stigmaeidae:Agistemus gratusadult female. Scale bars are 100 μm.
OMPS-LP ozone profiles retrieved at the University of Bremen - IUP
<p>This data set includes ozone profiles retrieved at the University of Bremen (IUP) from OMPS-LP observations. The retrieval range is 8.5 to 60.5 km. The format is harmonized according to ESA CCI guidelines. For detailed information about the retrieval and the data set, see "Retrieval of ozone profiles from OMPS limb scattering observations", Arosio, C. et al. (2018).</p>
Sexual Abusive Comments from YouTube by Roma Tre University
<p>1000 sexually abusive comments collected from popular YouTube Videos including cartoons like Peppa Pig</p>
Universal Concepts List of 17 Indo-European Languages
<p>Universal Concepts List (100-words, Swadesh 1971=final) with supposed Proto-Indo-European cognate stems, and their primary, “unmarked” translations in 17 representative old and recent IE languages<br> (This is the summary list of work in progress at detailed lists, and not thoroughly formatted)<br> Important note: This summary is exclusively aimed at glottochronological purposes. This, above all requires finding the most common, popular, everyday, “unmarked” translation for the given test meanings/concepts, which often will neither be the term scientists would choose, nor must be similar with the assumed meaning of the root. Only then the root has to be found, only in order to decide, which translations in the above sense are cognate or not. In most cases this aim does not necessarily require detailed notions of the grammar. Note further that pure loan pronunciations are glottochronologically not counted as replacements.</p>
Open Access levels of Dutch universities 2010-2017
<p>This small dataset contains csv data on the number of articles+reviews published by authors affiliated to Dutch Universities, 2010-2017, according to the Web of Science database, measured on 20171220. It also indicates the number of open access articles+reviews among those and the resulting percentages.</p> <p> </p>
Linked collectors and determiners for: University of Puerto Rico Mayagüez Invertebrate Collection.
Natural history specimen data linked to collectors and determiners held within, "University of Puerto Rico Mayagüez Invertebrate Collection". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="http://bionomia.net/dataset/43e54c60-d6e0-41df-80a3-ca9487a3342a">https://bionomia.net/dataset/43e54c60-d6e0-41df-80a3-ca9487a3342a</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/43e54c60-d6e0-41df-80a3-ca9487a3342a">https://gbif.org/dataset/43e54c60-d6e0-41df-80a3-ca9487a3342a</a>. Formatted as a Frictionless Data package.
rCRUX Generated MiFish Universal 12S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in January 2024.</p> <p>Primer Name: MiFish Universal<br>Gene: 12S<br>Length of Target: 163–185<br>get_seeds_local() minimum length: 170<br>get_seeds_local() maximum length: 400<br>blast_seeds() minimum length: 140<br>blast_seeds() maximum length: 400<br>max_to_blast: 1000<br>Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br>Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br>Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p> <p>This project was funded by the NOAA 'Omics Program.</p>
Рис. 1. Карта-схема литоральных Экспедиций Института биологии морЯ (Национального научного центра морской биологии им. А.В. Жирмунского ДВО РАН) и Дальневосточного государственого университета (Дальневосточного федерального университета) (по: Ivanova, Tsurpalo [2012], с дополнениЯми). Fig. 1. A schematic map of intertidal expeditions performed by the Institute of Marine Biology (A.V. Zhirmunsky National Scientific Centre of Marine Biology FEB RAS) and Far Eastern State University (Far Eastern Federal University) (after Ivanova, Tsurpalo [2012], with additions). in Bivalve mollusks of the intertidal zone of the Far Eastern seas of Russia
Рис. 1. Карта-схема литоральных Экспедиций Института биологии морЯ (Национального научного центра морской биологии им. А.В. Жирмунского ДВО РАН) и Дальневосточного государственого университета (Дальневосточного федерального университета) (по: Ivanova, Tsurpalo [2012], с дополнениЯми). Fig. 1. A schematic map of intertidal expeditions performed by the Institute of Marine Biology (A.V. Zhirmunsky National Scientific Centre of Marine Biology FEB RAS) and Far Eastern State University (Far Eastern Federal University) (after Ivanova, Tsurpalo [2012], with additions).
Linked collectors and determiners for: Freshwater benthic invertebrates ecological collection NTNU University Museum.
Natural history specimen data linked to collectors and determiners held within, "Freshwater benthic invertebrates ecological collection NTNU University Museum". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="http://bionomia.net/dataset/33591b80-0e31-480c-82ce-2f57211b10e6">https://bionomia.net/dataset/33591b80-0e31-480c-82ce-2f57211b10e6</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/33591b80-0e31-480c-82ce-2f57211b10e6">https://gbif.org/dataset/33591b80-0e31-480c-82ce-2f57211b10e6</a>. Formatted as a Frictionless Data package.
University of Notre Dame News: A Reading
I have done a bit of analysis -- reading -- against the set of news distributed by the University of Notre Dame, and below is some of what I learned.
Analyzing the University of Notre Dame's Theses & Dissertations
For a number of reasons, I spent some time analyzing a subset of the University of Notre Dame's theses & dissertations, and this missive outlines what I learned.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.