Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

13,397

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

13,397 results for “sp. nov.”

Learn how ShareScore rates datasets ↗
zenodo32/100

Supplementary material 2 from: Chao Y-S, Ebihara A, Chiou W-L, Huang Y-M (2017) Pteris latipinna sp. nov. (Pteridaceae), a new species segregated from Pteris fauriei. PhytoKeys 85: 95-108. https://doi.org/10.3897/phytokeys.85.14884

Figure S2. : Explanation note: Type material of Pteris fauriei var. minor Hieron. in B (U. Fauriei 685, B200128109).

opencc-by-4.0Aug 2017View details →
zenodo32/100

Supplementary material 1 from: Chao Y-S, Ebihara A, Chiou W-L, Huang Y-M (2017) Pteris latipinna sp. nov. (Pteridaceae), a new species segregated from Pteris fauriei. PhytoKeys 85: 95-108. https://doi.org/10.3897/phytokeys.85.14884

Figure S1. : Explanation note: Type material of Pteris fauriei Hieron. var. fauriei in B (B20012819).

opencc-by-4.0Aug 2017View details →
zenodo32/100

Supplementary material 3 from: Chao Y-S, Ebihara A, Chiou W-L, Huang Y-M (2017) Pteris latipinna sp. nov. (Pteridaceae), a new species segregated from Pteris fauriei. PhytoKeys 85: 95-108. https://doi.org/10.3897/phytokeys.85.14884

Figure S3. : Explanation note: Holotype of Pteris natiensis Tagawa in KYO (G. Koidzumi s.n. Aug. 3, 1922).

opencc-by-4.0Aug 2017View details →
zenodo32/100

Supplementary material 1 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppFig. 1: Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.

opencc-by-4.0Mar 2015View details →
zenodo32/100

Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.

opencc-by-4.0Mar 2015View details →
zenodo32/100

Supplementary material 3 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppFig. 3: Explanation note: Intragenomic variation in ITS sequences among the five clones sequenced from isolate GE09. 18S boundary ends with GATCATTA and 5.8S begins with CAACTTT, according to the convention of Hibbett et al. (1995).

opencc-by-4.0Mar 2015View details →
zenodo32/100

Supplementary material 4 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppTable 1: Explanation note: Details of ITS sequences falling into the Buwchfawromyces clade. The first five are all derived from the isolate GE09.

opencc-by-4.0Mar 2015View details →
zenodo32/100

FIGURE 2 in Observations on two Procamallanus (Spirocamallanus) species (Nematoda: Camallanidae) from freshwater fishes in Argentina, including description of Procamallanus (Spirocamallanus) juana sp. nov.

FIGURE 2. Procamallanus (Spirocamallanus) juana sp. nov. (SEM micrographs) (A) Male, cephalic end. Six pores (white arrows), amphids (black arrows). Scale=10µm. (B) Anterior end of male, sublateral view. Deirid (white arrow). Scale= 10µm. (C) Detail deirid. Scale=1µm. (D) Posterior end of male, ventral view. Preanal papillae (white arrows). Scale=10µm. (E) Female, vulva, subventral view. Scale=10µm. (F). Female, posterior end, lateral view. Scale=10µm.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 1 in Observations on two Procamallanus (Spirocamallanus) species (Nematoda: Camallanidae) from freshwater fishes in Argentina, including description of Procamallanus (Spirocamallanus) juana sp. nov.

FIGURE 1. Procamallanus (Spirocamallanus) juana sp. nov. (A) Male, anterior end, lateral view. (B) Male, head, lateral view. (C) Female, anterior end, lateral view. (D) Female, apical view. (E) Female, vulva, lateral view. (F) Female, tail, lateral view. (G) Male, posterior end with spicules and papillae, ventral view.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURES 1–7 in Nippostrongylus smalesae sp. nov. (Nematoda: Heligmonellidae) collected from Maxomys whiteheadi (Rodentia: Muridae) of Sumatra, Indoneisa

FIGURES 1–7. Male of Nippostrongylus smalesae sp. nov. collected from Maxomys whiteheadi in Riau, Sumatra, Indonesia. 1. Anterior end of holotype, left lateral view. 2. Cephalic end, apical view. 3. Cross section through midbody. Arrow indicating axis of orientation of synlophe. 4. Cross section through prebursal level. 5. Posterior end of holotype, left lateral view. 6. Bursa copulatrix, severed, ventral view. 7. Distal ends of spicules and gubernaculum. Abbreviations: D. dorsal; Dl. dorsal lobe; L. left; Ll. left lobe; R. right; Rl. right lobe; V. ventral.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURES 8–11 in Nippostrongylus smalesae sp. nov. (Nematoda: Heligmonellidae) collected from Maxomys whiteheadi (Rodentia: Muridae) of Sumatra, Indoneisa

FIGURES 8–11. Female of Nippostrongylus smalesae sp. nov. collected from Maxomys whiteheadi in Riau, Sumatra, Indonesia. 8. Cross section through midbody. Arrow indicating axis of orientation of synlophe. 9. Cross section through vestibule. 10 and 11. Posterior end of allotype showing ovejector (10), right lateral view and body ridges (11), left lateral view. Abbreviations: D. dorsal; L. left; R. right; V. ventral.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 6 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan

FIGURE 6. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, alive coloration of female paratype (a, b) and male holotype (ZMMU Ma 5839) (c).

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 3 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan

FIGURE 3. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, paratypes (a, c, d—ovigerous female; b, e—male): a, b—antennula; c, e—pereiopods I (chelipeds); d—distal propodus and chela of pereiopod I.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 7 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan

FIGURE 7. The map of records of representatives of the genus Athanas Leach, 1814 in the Sea of Japan and adjacent area. Empty sign indicates the type locality of the species.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 2 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan

FIGURE 2. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, paratypes (a, d, e–g—ovigerous female; b, c—male): a, b—front of carapace, dorsal view; c, d—front of carapace, lateral view; e—distal abdominal segments and telson, lateral view; f—telson; g—exopod of uropods.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 5 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan

FIGURE 5. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, paratype male, major pereiopod I: a— general view of pereiopod I; b—distal segments of pereiopod I; c, d—distal propodus and fingers of pereiopod I, different views.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 1 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan

FIGURE 1. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, general view of paratype female (a) and holotype male (ZMMU Ma 5839) (b).

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 3 in Coeliccia duytan sp. nov. from the Central Highlands of Vietnam (Odonata: Platycnemididae)

FIGURE 3. Coeliccia duytan sp. nov. (3a) head male; (3b) head female; (3c) prothorax female in lateral view; (3d) prothorax female in dorsal view; (3e) tip of abdomen, female.

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 2 in Coeliccia duytan sp. nov. from the Central Highlands of Vietnam (Odonata: Platycnemididae)

FIGURE 2. Coeliccia spp., ♂. [2a–c] Coeliccia duytan sp. nov.; [2d–f] Coeliccia hayashii. (2a, 2d) appendages in dorsal view; (2b, 2e) appendages in lateral view; (2c, 2f) genital ligula in dorsal view (2f from Fig. 4C, p. 411 in Phan & Kompier 2016).

opennotspecifiedSep 2017View details →
zenodo32/100

FIGURE 1 in Coeliccia duytan sp. nov. from the Central Highlands of Vietnam (Odonata: Platycnemididae)

FIGURE 1. Coeliccia spp., head and thorax, ♂. (1a) Coeliccia duytan sp. nov.; (1b) Coeliccia hayashii.

opennotspecifiedSep 2017View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record