Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
13,397
datasets available to search
ShareScore release 0.9.0
Dataset results
13,397 results for “sp. nov.”
Supplementary material 2 from: Chao Y-S, Ebihara A, Chiou W-L, Huang Y-M (2017) Pteris latipinna sp. nov. (Pteridaceae), a new species segregated from Pteris fauriei. PhytoKeys 85: 95-108. https://doi.org/10.3897/phytokeys.85.14884
Figure S2. : Explanation note: Type material of Pteris fauriei var. minor Hieron. in B (U. Fauriei 685, B200128109).
Supplementary material 1 from: Chao Y-S, Ebihara A, Chiou W-L, Huang Y-M (2017) Pteris latipinna sp. nov. (Pteridaceae), a new species segregated from Pteris fauriei. PhytoKeys 85: 95-108. https://doi.org/10.3897/phytokeys.85.14884
Figure S1. : Explanation note: Type material of Pteris fauriei Hieron. var. fauriei in B (B20012819).
Supplementary material 3 from: Chao Y-S, Ebihara A, Chiou W-L, Huang Y-M (2017) Pteris latipinna sp. nov. (Pteridaceae), a new species segregated from Pteris fauriei. PhytoKeys 85: 95-108. https://doi.org/10.3897/phytokeys.85.14884
Figure S3. : Explanation note: Holotype of Pteris natiensis Tagawa in KYO (G. Koidzumi s.n. Aug. 3, 1922).
Supplementary material 1 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 1: Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.
Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.
Supplementary material 3 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 3: Explanation note: Intragenomic variation in ITS sequences among the five clones sequenced from isolate GE09. 18S boundary ends with GATCATTA and 5.8S begins with CAACTTT, according to the convention of Hibbett et al. (1995).
Supplementary material 4 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppTable 1: Explanation note: Details of ITS sequences falling into the Buwchfawromyces clade. The first five are all derived from the isolate GE09.
FIGURE 2 in Observations on two Procamallanus (Spirocamallanus) species (Nematoda: Camallanidae) from freshwater fishes in Argentina, including description of Procamallanus (Spirocamallanus) juana sp. nov.
FIGURE 2. Procamallanus (Spirocamallanus) juana sp. nov. (SEM micrographs) (A) Male, cephalic end. Six pores (white arrows), amphids (black arrows). Scale=10µm. (B) Anterior end of male, sublateral view. Deirid (white arrow). Scale= 10µm. (C) Detail deirid. Scale=1µm. (D) Posterior end of male, ventral view. Preanal papillae (white arrows). Scale=10µm. (E) Female, vulva, subventral view. Scale=10µm. (F). Female, posterior end, lateral view. Scale=10µm.
FIGURE 1 in Observations on two Procamallanus (Spirocamallanus) species (Nematoda: Camallanidae) from freshwater fishes in Argentina, including description of Procamallanus (Spirocamallanus) juana sp. nov.
FIGURE 1. Procamallanus (Spirocamallanus) juana sp. nov. (A) Male, anterior end, lateral view. (B) Male, head, lateral view. (C) Female, anterior end, lateral view. (D) Female, apical view. (E) Female, vulva, lateral view. (F) Female, tail, lateral view. (G) Male, posterior end with spicules and papillae, ventral view.
FIGURES 1–7 in Nippostrongylus smalesae sp. nov. (Nematoda: Heligmonellidae) collected from Maxomys whiteheadi (Rodentia: Muridae) of Sumatra, Indoneisa
FIGURES 1–7. Male of Nippostrongylus smalesae sp. nov. collected from Maxomys whiteheadi in Riau, Sumatra, Indonesia. 1. Anterior end of holotype, left lateral view. 2. Cephalic end, apical view. 3. Cross section through midbody. Arrow indicating axis of orientation of synlophe. 4. Cross section through prebursal level. 5. Posterior end of holotype, left lateral view. 6. Bursa copulatrix, severed, ventral view. 7. Distal ends of spicules and gubernaculum. Abbreviations: D. dorsal; Dl. dorsal lobe; L. left; Ll. left lobe; R. right; Rl. right lobe; V. ventral.
FIGURES 8–11 in Nippostrongylus smalesae sp. nov. (Nematoda: Heligmonellidae) collected from Maxomys whiteheadi (Rodentia: Muridae) of Sumatra, Indoneisa
FIGURES 8–11. Female of Nippostrongylus smalesae sp. nov. collected from Maxomys whiteheadi in Riau, Sumatra, Indonesia. 8. Cross section through midbody. Arrow indicating axis of orientation of synlophe. 9. Cross section through vestibule. 10 and 11. Posterior end of allotype showing ovejector (10), right lateral view and body ridges (11), left lateral view. Abbreviations: D. dorsal; L. left; R. right; V. ventral.
FIGURE 6 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan
FIGURE 6. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, alive coloration of female paratype (a, b) and male holotype (ZMMU Ma 5839) (c).
FIGURE 3 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan
FIGURE 3. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, paratypes (a, c, d—ovigerous female; b, e—male): a, b—antennula; c, e—pereiopods I (chelipeds); d—distal propodus and chela of pereiopod I.
FIGURE 7 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan
FIGURE 7. The map of records of representatives of the genus Athanas Leach, 1814 in the Sea of Japan and adjacent area. Empty sign indicates the type locality of the species.
FIGURE 2 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan
FIGURE 2. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, paratypes (a, d, e–g—ovigerous female; b, c—male): a, b—front of carapace, dorsal view; c, d—front of carapace, lateral view; e—distal abdominal segments and telson, lateral view; f—telson; g—exopod of uropods.
FIGURE 5 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan
FIGURE 5. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, paratype male, major pereiopod I: a— general view of pereiopod I; b—distal segments of pereiopod I; c, d—distal propodus and fingers of pereiopod I, different views.
FIGURE 1 in Athanas alpheusophilus sp. nov. (Decapoda: Alpheidae) - a new Alpheus - associated shrimp from the Russian coast of the Sea of Japan
FIGURE 1. Athanas alpheusophillus sp. nov., Vitjaz, Posjeta Bay, the Sea of Japan, general view of paratype female (a) and holotype male (ZMMU Ma 5839) (b).
FIGURE 3 in Coeliccia duytan sp. nov. from the Central Highlands of Vietnam (Odonata: Platycnemididae)
FIGURE 3. Coeliccia duytan sp. nov. (3a) head male; (3b) head female; (3c) prothorax female in lateral view; (3d) prothorax female in dorsal view; (3e) tip of abdomen, female.
FIGURE 2 in Coeliccia duytan sp. nov. from the Central Highlands of Vietnam (Odonata: Platycnemididae)
FIGURE 2. Coeliccia spp., ♂. [2a–c] Coeliccia duytan sp. nov.; [2d–f] Coeliccia hayashii. (2a, 2d) appendages in dorsal view; (2b, 2e) appendages in lateral view; (2c, 2f) genital ligula in dorsal view (2f from Fig. 4C, p. 411 in Phan & Kompier 2016).
FIGURE 1 in Coeliccia duytan sp. nov. from the Central Highlands of Vietnam (Odonata: Platycnemididae)
FIGURE 1. Coeliccia spp., head and thorax, ♂. (1a) Coeliccia duytan sp. nov.; (1b) Coeliccia hayashii.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.