Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

285

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

285 results for “Anaerobe”

Learn how ShareScore rates datasets ↗
zenodo32/100

Data for the original research article 'Enhanced anaerobic digestion of dairy wastewater in a granular activated carbon amended sequential batch reactor'

<p>All data that support the findings of the&nbsp;study &#39;Enhanced anaerobic digestion of dairy wastewater in a granular activated carbon amended sequential batch reactor&#39; published in GCB Bioenergy Journal are&nbsp;openly available in the file.</p>

opencc-by-4.0Apr 2022View details →
zenodo32/100

Supplementary material 1 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppFig. 1: Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.

opencc-by-4.0Mar 2015View details →
zenodo32/100

Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.

opencc-by-4.0Mar 2015View details →
zenodo32/100

Supplementary material 3 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppFig. 3: Explanation note: Intragenomic variation in ITS sequences among the five clones sequenced from isolate GE09. 18S boundary ends with GATCATTA and 5.8S begins with CAACTTT, according to the convention of Hibbett et al. (1995).

opencc-by-4.0Mar 2015View details →
zenodo32/100

Supplementary material 4 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032

SuppTable 1: Explanation note: Details of ITS sequences falling into the Buwchfawromyces clade. The first five are all derived from the isolate GE09.

opencc-by-4.0Mar 2015View details →
zenodo32/100

Supplementary material 4 from: Joshi A, Lanjekar VB, Dhakephalkar PK, Callaghan TM, Griffith GW, Dagar SS (2018) Liebetanzomyces polymorphus gen. et sp. nov., a new anaerobic fungus (Neocallimastigomycota) isolated from the rumen of a goat. MycoKeys 40: 89-110. https://doi.org/10.3897/mycokeys.40.28337

Table S1 : Explanation note: Fermentation products of Liebetanzomyces polymorphus strain G1SC on different substrates after 5 d of incubation.

opencc-zeroOct 2018View details →
zenodo32/100

Supplementary material 3 from: Joshi A, Lanjekar VB, Dhakephalkar PK, Callaghan TM, Griffith GW, Dagar SS (2018) Liebetanzomyces polymorphus gen. et sp. nov., a new anaerobic fungus (Neocallimastigomycota) isolated from the rumen of a goat. MycoKeys 40: 89-110. https://doi.org/10.3897/mycokeys.40.28337

Figure S3 : Explanation note: The Non-metric multidimensional scaling (NMDS) plot showing clustering of various carbon sources based on fermentation products. Stress value, 0.012.

opencc-zeroOct 2018View details →
zenodo32/100

Supplementary material 1 from: Joshi A, Lanjekar VB, Dhakephalkar PK, Callaghan TM, Griffith GW, Dagar SS (2018) Liebetanzomyces polymorphus gen. et sp. nov., a new anaerobic fungus (Neocallimastigomycota) isolated from the rumen of a goat. MycoKeys 40: 89-110. https://doi.org/10.3897/mycokeys.40.28337

Figure S1 : Explanation note: Photographs showing fungal thalli (marked by arrows) of Liebetanzomyces polymorphus attached to the sides (A) and bottom (B) of glass bottles when grown in liquid medium.

opencc-zeroOct 2018View details →
zenodo32/100

Supplementary material 2 from: Joshi A, Lanjekar VB, Dhakephalkar PK, Callaghan TM, Griffith GW, Dagar SS (2018) Liebetanzomyces polymorphus gen. et sp. nov., a new anaerobic fungus (Neocallimastigomycota) isolated from the rumen of a goat. MycoKeys 40: 89-110. https://doi.org/10.3897/mycokeys.40.28337

Figure S2 : Explanation note: The ITS1 based maximum-likelihood tree based on the Tamura 3-parameter model (Tamura 1992) is showing the phylogenetic position of Liebetanzomyces polymorphus with nearest uncultured clones. The genus Anaeromyces mucronatus (accession number: NR_111156) was used as the outgroup. Bootstrap values (&gt;50%) based on 500 replicates are indicated at branching points. The GenBank accession number of each strain is listed before the name. Bar, 0.02 substitutions per site.

opencc-zeroOct 2018View details →
zenodo32/100

Figure 8 in Molecular phylogeny and taxonomy of three anaerobic plagiopyleans (Alveolata: Ciliophora), retrieved from two geographically distant localities in Asia and North America

Figure 8. Maximum likelihood (ML) tree inferred from the small subunit rRNA gene sequences, revealing the positions of the 21 newly obtained sequences (red font). Numbers near branches indicate ML bootstrap values and BI posterior probabilities. Black circles represent full support (ML/BI, 100/1.00) in both analyses. Disagreements in topology between ML and BI are marked with asterisks. The scale bar corresponds to 2 changes per 100 nucleotide positions. Abbreviation: sp = species.

opennotspecifiedJul 2023View details →
zenodo32/100

Figure 4 in Molecular phylogeny and taxonomy of three anaerobic plagiopyleans (Alveolata: Ciliophora), retrieved from two geographically distant localities in Asia and North America

Figure 4. Drawings of Plagiopyla rariseta from life (A–C, E) and aħer protargol staining (D, F–I). A, ventral view of a representative individual, arrowheads show caudal cilia. B, C, resting (B) and extruded (C) extrusomes. D, dorsal view, showing position of striated band, cytoproct (red arrow), dense ciliary row (black arrow) and contractile vacuole pores (arrowheads). E, different body shapes. F, details of oral region, showing oral opening and buccal cavity. G, details of dikinetids on right front side of striated band. H, I, ventral (H) and dorsal (I) views of the holotype to show somatic and oral kineties, arrow indicates striated band, arrowhead shows dense ciliary row, red kinetosomes indicate dikinetids on right front side of striated band. Abbreviations: CV, contractile vacuole; Ex, extrusomes; SB, striated band. Scale bars: 30 μm (A, E, H, I), 25μm (C).

opennotspecifiedJul 2023View details →
zenodo32/100

Figure 5 in Molecular phylogeny and taxonomy of three anaerobic plagiopyleans (Alveolata: Ciliophora), retrieved from two geographically distant localities in Asia and North America

Figure 5. Photomicrographs of Plagiopyla rariseta from life (A–C, H–O) and aħer protargol staining (D–G). A, B, ventral views of different individuals, showing different body shape. C, extruded extrusomes (arrowheads). D, details of oral opening and buccal cavity tube (arrowhead). E, macronucleus and slightly enveloped micronucleus (arrowhead). F, G, ventral (F) and dorsal (G) views of the holotype to show somatic and oral kineties, arrowhead shows dense ciliary row. H, I, oral region, showing buccal cavity (arrowheads) under different focal planes. J, ventral view of a slightly compressed cell. K, posterior region of cell, arrowhead indicates contractile vacuole, arrow marks cortical ridges. L, curved extrusomes (arrowheads) under the cortex. M, posterior end of cell, showing caudal cilia (arrowhead). N, contractile vacuole pores (arrowheads). O, dorsal view, arrowhead shows striated band. Scale bars: 30 μm.

opennotspecifiedJul 2023View details →
zenodo32/100

Figure 2 in Molecular phylogeny and taxonomy of three anaerobic plagiopyleans (Alveolata: Ciliophora), retrieved from two geographically distant localities in Asia and North America

Figure 2. Drawings of Trimyema foissneri from life (A–D) and aħer protargol staining (E–I). A, leħ lateral view of a representative individual, arrow shows acontractile vacuole, red arrowhead shows food vacuole, yellow arrowheads show somatic cilia. B, different body shape in different viewing angles. C, leħ lateral view, showing buccal cavity (arrow) and position of macronucleus. D, disposition of the ciliary girdles. E, oral ciliature, red dots showing kinetidal composition at the anterior part of OK1. F, lateral view of oral ciliature, showing the shorter oral kinety 3 (in red). G, macronucleus and micronucleus (arrowheads), the position of the laưer being variable (1, 2). H, I, ventral (H) and dorsal (I) views of the holotype to show somatic and oral kineties, arrows show argentophilic lines connecting longitudinal somatic ciliary rows, arrowheads show epaulet. Abbreviations: CC, caudal cilia; Ma, macronucleus; OK, oral kinety; SK, somatic kineties; VLF, ventrolateral fragment. Scale bars: 15 μm (A, C); 10 μm (H, I).

opennotspecifiedJul 2023View details →
zenodo32/100

Figure 6 in Molecular phylogeny and taxonomy of three anaerobic plagiopyleans (Alveolata: Ciliophora), retrieved from two geographically distant localities in Asia and North America

Figure 6. Drawings of Plagiopyla frontata from life (A–C, E, F) and after protargol staining (D, G–I). A, ventral view of a representative individual, arrowheads show caudal cilia. B, tangential section of the cortex, arrowhead marks straight extrusome, arrow indicates curved extrusome. C, extruded extrusomes with one end slightly inflated (red arrowheads). D, details of oral region, showing oral opening and buccal cavity (arrow). E, F, different cell shapes. G, dorsal view of a compressed cell, showing position of striated band, cytoproct (black arrow), dense ciliary rows (red arrow), and contractile vacuole pores (red arrowheads). H, ventral view to show somatic and oral kineties, arrowhead indicates gap between upper oral lip kineties and somatic kineties. I, dorsal view to show somatic kineties, arrow indicates striated band, arrowhead shows dense ciliary rows, double-arrowhead shows several irregularly and densely packed kinetosomes located near loop of striated band. Abbreviations: CV, contractile vacuole; Ma, macronucleus; SB, striated band. Scale bars: 35 μm (A, E, G, H); 10 μm (C).

opennotspecifiedJul 2023View details →
zenodo32/100

Figure 7 in Molecular phylogeny and taxonomy of three anaerobic plagiopyleans (Alveolata: Ciliophora), retrieved from two geographically distant localities in Asia and North America

Figure 7. Photomicrographs of Plagiopyla flontata in vivo (A–H) and aħer protargol staining (I–M). A, ventral view of a slightly compressed cell, arrow marks buccal cavity. B, representative individual, arrow shows oral opening, arrowhead indicates contractile vacuole. C, extruded extrusomes with one end slightly inflated (arrowheads). D, contractile vacuole pores (red arrowheads). E, ventral view of a compressed cell, arrows show straight extrusomes, arrowheads show curved extrusomes. F, details of dorsal side, arrowhead shows cytoproct. G, right side of a compressed cell showing striated band (arrowhead). H, details of extrusomes. I, macronucleus and micronucleus (white arrowhead). J, K, oral region, showing buccal cavity under different focal planes. L, M, ventral (L) and dorsal (M) views of the same individual, showing somatic and oral kineties, red arrow indicates gap between upper oral lip kineties and somatic kineties, black arrow shows striated band, black arrowhead shows dense ciliary rows, red arrowhead indicates several polykineties located near loop of striated band. Abbreviation: Ma, macronucleus. Scale bars: 35 μm.

opennotspecifiedJul 2023View details →
zenodo32/100

Figure 3 in Molecular phylogeny and taxonomy of three anaerobic plagiopyleans (Alveolata: Ciliophora), retrieved from two geographically distant localities in Asia and North America

Figure 3. Photomicrographs of Trimyema foissneri from life (A–C, J–M) and aħer protargol staining (D–I, N–º). A, B, right lateral views of different individuals, showing different body shape. C, right lateral views of a slightly compressed individual, arrowhead marks caudal cilia. D, macronucleus and micronucleus (arrowhead). E, cytopharynx fibres (arrowhead). F, lateral view of anterior part of cell, showing two longer oral kineties and a shorter one (arrowhead). G–I, right lateral (G, I) and dorsal (H) view, showing epaulet (arrowheads). J, ventral view, arrowhead indicates oval buccal cavity. K, anterior region, showing buccal cavity (arrowhead). L, lateral view of cell, showing three oblique somatic ciliary girdles. M, anterior part of cell, arrowheads show dents on surface. N, argentophilic lines (arrowhead) connected longitudinal somatic ciliary rows. O, details of oral region, arrowheads indicate kinetids at anterior part of oral kinety 1. P, º, ventral view of the holotype (P) and a paratype (º), showing somatic kineties, oral kineties and different ventro-lateral fragment (red circle), black arrowhead shows first oral kineties, arrow shows second oral kineties, red arrowheads show mucocysts. Abbreviations: G1, first ciliary girdle; G2, second ciliary girdle; G3, third ciliary girdle; Ma, macronucleus; OK1, first oral kineties; OK2, second oral kineties; VLF, ventrolateral fragment. Scale bars: 15 μm (A–C); 10 μm (G, P, º).

opennotspecifiedJul 2023View details →
ClinicalTrials.gov32/100

Effect of Lyophilized Cornelian Cherry on Anaerobic Performance in Young Football Players

ClinicalTrials.gov study NCT07114341. IPD Sharing: NO. Countries: 1. Publications: 15.

closedIPD-NOFeb 2026View details →
ClinicalTrials.gov32/100

Beetroot Juice: Anaerobic Performance and Fatigue in Swimmers

ClinicalTrials.gov study NCT06461117. IPD Sharing: NO. Countries: 1. Publications: 4.

closedIPD-NOFeb 2026View details →
ClinicalTrials.gov32/100

Core Strength Training on Anaerobic Power And Core Strength in Basketball Players

ClinicalTrials.gov study NCT05568771. IPD Sharing: Not stated. Countries: 1. Publications: 2.

restrictedIPD-UNDECIDEDFeb 2026View details →
ClinicalTrials.gov32/100

Effects of Short- Term Intermittent Fasting Aerobic and Anaerobic Capacity

ClinicalTrials.gov study NCT04756635. IPD Sharing: YES. Countries: 1. Publications: 1.

controlledIPD-YESFeb 2026View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record