Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,109
datasets available to search
ShareScore release 0.9.0
Dataset results
3,109 results for “Sequence analysis”
Figure 3 in Diceratocephala boschmai (Platyhelminthes: Temnocephalida) from crayfish farms in Thailand: investigation of the topographic surface and analysis of 18S ribosomal DNA sequences
Figure 3. The neighbor-joining phylogenetic tree based on the 18S rDNA gene, showing the relationships of D. boschmai with 29 other turbellarian species.
Figure 2 in Diceratocephala boschmai (Platyhelminthes: Temnocephalida) from crayfish farms in Thailand: investigation of the topographic surface and analysis of 18S ribosomal DNA sequences
Figure 2. Surface topography of D. boschmai. A–C) Unhatched and hatched eggs; D) ventral view of a specimen; E) mouth with protruding pharynx; F) thread-like filaments adhered to the pharynx; G, H) a higher magnification of write-dot boxes in 2E; I, J) a higher magnification of write-dot boxes in 2D; K) ventral view of a specimen at posterior end; L) dorsal view of a specimen; M) a higher magnification of write-dot box in Figure L. ad, adhesive disc; af, adhered filaments; ci, ciliated cell; ds, double spines; fi, filament; gr, groove; gv, gravel-like units; in, intertentacular flange; mo, mouth; op, opercular plate; pe, peduncle; pi, pit; sp, single spine; tb, trabecular meshwork; tc, tentacle; th, thread-like filaments; tr, trunk; vi, villi..
Figure 1. A in Diceratocephala boschmai (Platyhelminthes: Temnocephalida) from crayfish farms in Thailand: investigation of the topographic surface and analysis of 18S ribosomal DNA sequences
Figure 1. A) C. destructor harboring adult D. boschmai and eggs of flatworm; B) dorsal view of an extending body; C) diagram of organ structures in dorsal view; D) diagram of reproductive complex; E, F) photomicrograph and diagram of penial stylet, respectively; G) unhatched and hatched eggs. ad, adhesive disc; at, atrium; cv, contractile vesicle; ds, dorsal side; es, ejaculatory sac; ey, eye; ev, excretory vesicle; fi, filament; in, intertentacular flange; ine, intestine; int, introvert; mo, mount; ov, ovary; pe, peduncle; pf, plane of fracture; ph, pharynx; pn, subepidermal pigment network; ps, penial stylet; rv, resorbens vesicle; s, stalk; se, seminal vesicle; sr, seminal receptacle; sp, sclerotized papillae; tc, tentacle; te, testis; tg, tentacular gland; ve, vasa efferentia; vg, vagina; vi, vitellaria; vs, ventral side.
Text-fig. 4. Electrophoresis after amplification: Electrophoretical analysis of mitochondrial DNA. mtDNA sequences were amplified by primers F15.412 and R16.169 (450 bp), R16.269 (550 bp), R16.519 (800 bp). Lane 1 are primers F15.412 + R16.169, lane 2 primers F15.412 + R16.269, lane 3 primers F15.412 + R16.519, NC – negative control – water, L – 100 bp DNA ladder (band size from 100 bp to 1500 bp). in Genetic Analysis Of Possibly The Oldest Greyhound Remains Within The Territory Of The Czech Republic As Proof Of A Local Elite Presence At Chotěbuz-Podobora Hillfort In The 8 -9 Century Ad
Text-fig. 4. Electrophoresis after amplification: Electrophoretical analysis of mitochondrial DNA. mtDNA sequences were amplified by primers F15.412 and R16.169 (450 bp), R16.269 (550 bp), R16.519 (800 bp). Lane 1 are primers F15.412 + R16.169, lane 2 primers F15.412 + R16.269, lane 3 primers F15.412 + R16.519, NC – negative control – water, L – 100 bp DNA ladder (band size from 100 bp to 1500 bp).
Text-fig. 5. Multiple sequence alignment of mtDNA from ancient bone and recent greyhound, (Gundry et al. 2007) primer pair A – F15.719 and R16.114. in Genetic Analysis Of Possibly The Oldest Greyhound Remains Within The Territory Of The Czech Republic As Proof Of A Local Elite Presence At Chotěbuz-Podobora Hillfort In The 8 -9 Century Ad
Text-fig. 5. Multiple sequence alignment of mtDNA from ancient bone and recent greyhound, (Gundry et al. 2007) primer pair A – F15.719 and R16.114.
Figure. Phylogram showing phylogenetic relationships estimated using maximum likelihood analysis of 16S rRNA and COXI gene revealed the grouping of Orthochirus iranus, O. farzanpay, O. stockwelli, O. zagrosensis, O. innesi (JQ514244.1 Morocco), and O. bicolor (KT716038.1 India), with the outgroup species Androctonus crassicauda (FJ217732). in A study of genetic diversity among different population of Orthochirus sp. based on cytochrome C oxidase subunit I and 16srRNA sequencing
Figure. Phylogram showing phylogenetic relationships estimated using maximum likelihood analysis of 16S rRNA and COXI gene revealed the grouping of Orthochirus iranus, O. farzanpay, O. stockwelli, O. zagrosensis, O. innesi (JQ514244.1 Morocco), and O. bicolor (KT716038.1 India), with the outgroup species Androctonus crassicauda (FJ217732).
Fig. 3 in Investigating the pathogens associated with Dermacentor nuttalli and its global distribution: A study integrating metagenomic sequencing, meta-analysis and niche modeling
Fig. 3. Prevalence of pathogens associated with D. nuttalli. If there was only one study included in a certain pathogen, the positive rate would be calculated by the positive number of ticks divided by the total number of detected ticks, and without the 95% confidence interval. If there were more studies, the positive rate and 95% confidence interval would be calculated by meta-analysis.
Fig. 2 in Investigating the pathogens associated with Dermacentor nuttalli and its global distribution: A study integrating metagenomic sequencing, meta-analysis and niche modeling
Fig. 2. Study design and data sources of the meta-analysis. A comprehensive meta-analysis was performed to evaluate D. nuttalli's potential threats based on detected pathogens and geographical distribution positions. The database of D. nuttalli was constructed from four sources, including field surveys, literature review, a reference book, and an online biodiversity database (Global Biodiversity Information Facility, GBIF, https://www.gbif.org).
Fig. 1 in Investigating the pathogens associated with Dermacentor nuttalli and its global distribution: A study integrating metagenomic sequencing, meta-analysis and niche modeling
Fig. 1. Relative pathogen abundance of four D. nuttalli samples and the phylogenomic analysis of four Rickettsia genomes. (A) Pathogen abundance at the family level. (B) Pathogen abundance at the genus level. (C) The phylogenetic tree of four Rickettsia assemblies. The phylogenetic tree of four Rickettsia assemblies (Rickettsia conorii subsp. raoultii str XinjiangF1, Rickettsia conorii subsp. raoultii str XinjiangF2, Rickettsia conorii subsp. raoultii str XinjiangF3, and Rickettsia conorii subsp. raoultii str XinjiangM1) was built with 28 other publicly available established or proposed Rickettsiales species. The tree was inferred by IQ-TREE based on 277 single-copy orthologs identified by OrthoFinder. Anaplasma phagocytophilum and Ehrlichia ruminantium were two outgroup species.
Fig. 5 in Investigating the pathogens associated with Dermacentor nuttalli and its global distribution: A study integrating metagenomic sequencing, meta-analysis and niche modeling
Fig. 5. Global potential distribution of D. nuttalli. The red area indicates greater possibilities of suitability for D. nuttalli, while the blue area is less likely to be suitable for D. nuttalli.
Fig. 4 in Investigating the pathogens associated with Dermacentor nuttalli and its global distribution: A study integrating metagenomic sequencing, meta-analysis and niche modeling
Fig. 4. Geographical distribution of D. nuttalli. D. nuttalli lived mainly between 23◦–53◦ latitude and 76◦–133◦ longitude in the Northern Hemisphere. Triangles represent the locations in prefecture-level regions, while circles represent the distribution locations in county-level regions. The green circles represent points from GBIF, the yellow circles are points from literature, the purple circles represent the points from the field survey and the blue points are points from a reference book. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Fig. 1 in Polymerase chain reaction and gyrA nucleotide sequence analysis of Wolbachia endosymbionts (Rickettsiales: Anaplasmataceae) in various species of Culicidae, Cimex lectularius (Hemiptera: Cimicidae) and Dirofilaria immitis (Rhabditida: Onchocercidae)
Fig. 1. Phylogenetic tree based on Maximum Likelihood depicting the grouping of Wolbachia from various hosts based on analysis of the gyrA gene. The numerical value displayed on branches is the bootstrap value (1,000 replicates), and branches with values below 50% are collapsed. The tree illustrates that gyrA sequences distinguish Wolbachia subtypes based on host taxonomy, demonstrating that this gene may contribute to Wolbachia strain typing projects and future phylogenetic analysis.
Representative snapshots of imaging sequences used in transcan_IDH-mutant_LGG_radiomics analysis
Open the record for dataset details and reuse information.
Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.
Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.
Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Fig 1 in Evolutionary relationships of Macaca fascicularis fascicularis (Raffles 1821) (Primates: Cercopithecidae) from Singapore revealed by Bayesian analysis of mitochondrial DNA sequences
Fig 1. Map of Southeast Asia showing the approximate location of the new (Singapore and Bali) and GenBank sequences included in the study. Numbers correspond to the following locations (haplotype IDs in parentheses): ★, Singapore (Sing1–3); 1, Vietnam (Viet1 & 2); 2, Cambodia (Camb1 & 2); 3, Thailand (Thai1); 4, Thailand (Thai2); 5, Malaysia (Selangor1 & 2); 6, Malaysia (Johor); 7, south Sumatra, Indonesia (Sumatra1 & 2, Java1); 8, Java (Java1); 9, Kalimantan, Borneo (Borneo3); 10, Sarawak, Borneo (Borneo1); 11, Sepilok, Borneo (Borneo2); 12, Bali, Indonesia (Bali1 & 2); 13, Sibuyan, Philippines (Phil1); 14, Bangkok, Thailand (Thai3 & 4); 15, Malaysia (W. Malay); 16, Malaysia (E. Malay2); 17 Malaysia (E. Malay1);18, north Sumatra (Sumatra3–6, 9); 19, west Borneo, Indonesia (Borneo9); 20, west Borneo, Indonesia (Borneo4–7); 21, central Borneo, Indonesia (Borneo4 & 6); 22, Bangka, south Sumatra (Sumatra 7 & 8); 23, Java, Indonesia (Java2 & 3); 24, northeast Borneo, Indonesia (Borneo8); 25, Mindanao, Philippines (Phil2); 26, Timor (Timor). Several Borneo haplotypes appear in multiple locations.
Fig 4. Median-joining haplotype network for M in Evolutionary relationships of Macaca fascicularis fascicularis (Raffles 1821) (Primates: Cercopithecidae) from Singapore revealed by Bayesian analysis of mitochondrial DNA sequences
Fig 4. Median-joining haplotype network for M. fascicularis. The size of the circular nodes representing haplotypes is proportional to the number of sequences comprising the haplotype. Shading of circular nodes corresponds to general geographic groupings including Sundaic islands (white), mainland Indochina (gray), Malay Peninsula and northern Sumatra (dark gray), and Singapore (black). Haplotype identifications are presented in Table 1.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.