Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
8,175
datasets available to search
ShareScore release 0.9.0
Dataset results
8,175 results for “additive”
Patents and certificates of addition granted in France from 1904 to 1921 by applicant's country
<p>**TITRE**<br> Etat des brevets d'invention et des certificats d'addition délivrés en France entre 1904 et 1921 par pays d'origine du demandeur.</p> <p>**VARIABLES**</p> <p>YEAR : année de délivrance<br> COUNTRY : le nom donné est le nom qui apparaît dans la source originale. Il n'est simplifié que pour quelques pays (Argentine, Luxembourg,...)<br> NUMBER : le nombre de brevets d'invention et de certificats d'addition délivrés.</p> <p>**OBSERVATIONS**<br> Pour l'année 1904, le nombre correspond au nombre de demandes de brevets et de certificats d'addition</p> <p>**SOURCES**<br> année 1904, <em>La Propriété industrielle</em>, avril 1906, p. 59-60 ; année 1905, <em>La Propriété industrielle</em>, mai 1907, p. 74-76 ; année 1906, <em>La Propriété industrielle</em>, juillet 1908, p 109-110 ; année 1907, <em>Bulletin officiel de la propriété industrielle et commerciale</em>, 1908, p. 32 ; année 1908, <em>La Propriété industrielle</em>, janvier 1910, p. 13-14 ; année 1909, <em>La Propriété industrielle</em>, mars 1911, p. 42-43 ; année 1910, <em>La Propriété industrielle</em>, janvier 1913, p. 15-16 ; année 1911, <em>La Propriété industrielle</em>, avril 1914, p. 63-64 ; année 1912, <em>Bulletin officiel de la propriété industrielle et commerciale</em>, 1913, p. 23-24 ; année 1913, <em>La Propriété industrielle</em>, janvier 1915, p. 11-12 ; années 1914 et 1915, <em>La Propriété industrielle</em>, mai 1917, p. 67-68 ; année 1916, <em>La Propriété industrielle</em>, août 1918, p. 95-96 ; année 1917, <em>La Propriété industrielle</em>, janvier 1919, p. 11-12 ; années 1918, 1919 et 1920, <em>La Propriété industrielle</em>, juin 1922, p. 91-92 ; année 1921, <em>Bulletin officiel de la propriété industrielle et commerciale</em>, 1922, p. 36.</p> <p>**TITLE**<br> Number of patents granted and certificates of addition in France between 1904 and 1921 by applicant's country</p> <p>**VARIABLES**</p> <p>YEAR : year of issue<br> COUNTRY : the name given is the one that appears in the original source. It is only simplified for a few countries (Argentina, Luxembourg,...).<br> NUMBER : the number of patents and certificates of addition granted.</p> <p>**OBSERVATIONS**<br> For the year 1904, the number corresponds to the number of applications for patents and certificates of addition.</p> <p>**SOURCES**<br> year 1904, <em>La Propriété industrielle</em>, avril 1906, p. 59-60 ; year 1905, <em>La Propriété industrielle</em>, mai 1907, p. 74-76 ; year 1906, <em>La Propriété industrielle</em>, juillet 1908, p 109-110 ; year 1907, <em>Bulletin officiel de la propriété industrielle</em>, 1908, p. 32 ; year 1908, <em>La Propriété industrielle</em>, janvier 1910, p. 13-14 ; year 1909, <em>La Propriété industrielle</em>, mars 1911, p. 42-43 ; year 1910, <em>La Propriété industrielle</em>, janvier 1913, p. 15-16 ; year 1911, <em>La Propriété industrielle</em>, avril 1914, p. 63-64 ; year 1912, <em>Bulletin officiel de la propriété industrielle</em> <em>et commerciale</em>, 1913, p. 23-24 ; year 1913, <em>La Propriété industrielle,</em> janvier 1915, p. 11-12 ; years 1914 et 1915, La Propriété industrielle, mai 1917, p. 67-68 ; year 1916, <em>La Propriété industrielle</em>, août 1918, p. 95-96 ; year 1917, <em>La Propriété industrielle</em>, janvier 1919, p. 11-12 ; years 1918, 1919 et 1920, <em>La Propriété industrielle</em>, juin 1922, p. 91-92 ; year 1921, <em>Bulletin officiel de la propriété industrielle et commerciale</em>, 1922, p. 36. </p>
Additional TAU datasets for Wi-Fi fingerprinting-based positioning
<p><strong>1. Contents</strong></p> <p>This document describes two datasets collected at Tampere University facilities with samples taken from a Wi-Fi network interface for experiments with indoor positioning based on Wi-Fi fingerprinting.</p> <p>To reference this dataset, please use</p> <p>E.S. Lohan et al. “Additional TAU datasets for Wi-Fi fingerprinting-based positioning” 10.5281/zenodo.3819917</p> <p>Additional reference using these datasets</p> <p><em>Torres-Sospedra, J.; Quezada-Gaibor, D.; Mendoza-Silva, G. M.; Nurmi, J.; Koucheryavy, Y. and Huerta, J. New Cluster Selection and Fine-grained Search for k-Means Clustering and Wi-Fi Fingerprinting Proceedings of the Tenth International Conference on Localization and GNSS (ICL-GNSS), 2020.</em></p> <p><strong>Dataset format</strong></p> <p>Two independent datasets are provided, they are in different folders, namely “Database_Building01” and “Database_Building02” respectively. Each dataset includes two sets of samples:</p> <ul> <li>radio map – a set of Wi-Fi samples collected at a grid of points (reference points);</li> <li>evaluation – a set of Wi-Fi samples randomly collected in the evaluation area.</li> </ul> <p>Two files are provided for each set that include the rss vectors and the coordinates. For the radio map, the provided files have their names starting with “rm_”; for the evaluation, the evaluation files have their names starting with “eval_”. For instance, for the radio map they are:</p> <ul> <li>rm_crd.csv: holds coordinates (x,y)and floor identifier (z) where the samples were collected;</li> <li>rm_rss.csv: holds the measured RSSI values from each of the Access Points (AP) detected in each sample;</li> </ul> <p>All the file are described in the same format, and all files are CSV – Comma Separated Values plain text (UTF-8).</p> <p><strong>Coordinates:</strong> Each sample is associated to a pair of coordinates in a 2D Euclidean reference system. The origin of the reference system was chosen arbitrarily for convenience. The units are meters. Therefore, distances between points can be easy calculated. Moreover, the floor identifier is included to enable 3D positioning.</p> <p><strong>RSSI values:</strong> The RSSI values provided as read from the Wi-Fi network interface through the Android API. In each sample, a value of +100 was assigned to each AP not detected during a measurement. No information is provided about the MAC addresses of the APs. However, in the files, the same order is used for all samples, meaning that the values in each column are all associated to the same AP.</p> <p>Both datasets are independent and none of the provided files include an identifier for each sample. The values in the two provided files are associated by the line number, meaning that the coordinates and RSSI values in the same line, in each file, refer to the same sample.</p>
Photographs of the article and additional photographs (Cairo, Egypt).
<p>Four photographs published in the paper :</p> <p>Vincent Battesti & Nicolas Puig, 2020 — « Towards a sonic ecology of urban life: Ethnography of sound perceptions in Cairo ». <em>The Senses & Society</em>, 15 (2), p. 170-191, doi: 10.1080/17458927.2020.1763606 — online: https://hal.archives-ouvertes.fr/hal-02890453</p> <p>… and extra pictures of Cairo (Egypt).</p>
Eddy Kinetic Energy and SST gradients global datasets and trends. Additionally, this dataset includes ocean basins and ocean processes masks.
<p>This dataset includes the post-processed data used for the paper titled "Mesoscale kinetic energy response to changing oceans". The original data was obtained from AVISO+ SSH altimetry and NOAA optimal interpolated sea surface temperature (OISST):</p> <p>AVISO+ SSH: https://www.aviso.altimetry.fr/en/data/products/sea-surface-height-products/global/gridded-sea-level-heights-and-derived-variables.html</p> <p>NOAA-OISST: https://www.ncdc.noaa.gov/oisst</p> <p>From satellite observations of sea surface height (SSH) and sea surface temperature (SST) over the satellite record (1993 - 2019), EKE and SST gradients are derived. </p> <p>Then the fields are then temporally smoothed using a running average of 12 months. Trends and the significance of each field are finally computed with linear regression and a modified Mann–Kendall test (https://github.com/josuemtzmo/xarrayMannKendall).</p> <p>Geographical regions consist of the following ocean basins: the Southern Ocean, the Indian Ocean, the Pacific Ocean, and the Atlantic ocean. These ocean basins were expert-defined to capture ocean processes at all scales (ocean_basins_and_dynamical_masks.nc).</p> <p>Dynamical regions (Fig. 5d): the Antarctic Circumpolar Current (ACC), the boundary currents and their extensions, the tropics, the subtropical ocean gyres, and the remaining regions (ocean_basins_and_dynamical_masks.nc).</p> <p>Further information and scripts to reproduce the result of the manuscript can be found at: https://github.com/josuemtzmo/EKE_SST_trends</p>
Mapping of FoodEx2 Exposure Hierarchy with the food categories of Annex II (part D) of Regulation (EC) No 1333/2008 on food additives
<p>FoodEx2 is a comprehensive food classification and description system aimed at covering the need to describe food in data collections across different food safety domains. All foods, including beverages and food supplements reported in the EFSA Comprehensive Food Consumption Database are coded with the FoodEx2 Exposure Hierarchy. EFSA developed a mapping of all FoodEx2 basic terms reported in the Comprehensive Database with the food categories of Annex II (part D) of Regulation (EC) No 1333/2008 on food additives in order to facilitate the assessment of exposure to food additives. In particular, this mapping has been used in the Food Additives Intake Model 2.0 (FAIM), which allows the estimation of chronic dietary exposure to food additives based on use levels proposed for food categories as presented in Annex II (part D) of Regulation (EC) No 1333/2008 on food additives.</p> <p>Some of the food categories, restrictions and/or exceptions presented in the Regulation could have not been mapped with FoodEx2 basic terms and the original food descriptors and/or FoodEx2 facets might have been used to correctly map all eating events. This information might not be available in this table.</p>
Contour method dataset for as-deposited and rolled wire+arc additive manufacturing Ti–6Al–4V components
<p>This is an archive of the raw metrology of the EDM cut surface data files used for the contour method analysis of Wire+Arc Additive Manufacture (WAAM) Ti6Al4V components appearing in: "Residual stress of as-deposited and rolled wire+arc additive manufacturing Ti–6Al–4V components" by F. Martina, M. J. Roy, B. A. Szost, S. Terzi, P. A. Colegrove, S. W. Williams, P. J. Withers, J. Meyer and M. Hofmann.</p> <p>The files are described by their filenames and side of each EDM cut. For example, 'Control_1.dat' refers to one side of the cut performed on the as-deposited specimen, while '50kN_1.dat' refers to one side of a specimen rolled at 50 kN load, etc.</p> <p>Data is in the form of a point cloud with one point per line, whitespace delimited in microns. Data was captured with a Nanofocus CF-4 laser profilometer sensor with point spacing 30 µm apart. Data with z coordinates below or above 500 µm are considered outside of the surface detection limits.</p>
Additive interfacial chiral interaction in multilayers for stabilization of small individual skyrmion at room temperature
<p>International audience Facing the ever-growing demand for data storage will most probably require a new paradigm. Nanoscale magnetic skyrmions are anticipated to solve this issue as they are arguably the smallest spin textures in magnetic thin films in nature. We designed cobalt-based multilayered thin films where the cobalt layer is sandwiched between two heavy metals providing additive interfacial Dzyaloshinskii-Moriya interactions, which reach a value close to 2 mJ m-2 in the case of the Ir|Co|Pt asymmetric multilayers. Using a magnetization-sensitive scanning x-ray transmission microscopy technique, we imaged small magnetic domains at very low field in these multilayers. The study of their behavior in perpendicular magnetic field allows us to conclude that they are actually magnetic skyrmions stabilized by the large Dzyaloshinskii-Moriya interaction. This discovery of stable sub-100 nm individual skyrmions at room temperature in a technologically relevant material opens the way for device applications in a near future. on</p>
A Corpus of Biblical Names in the Greek New Testament to Study the Additions, Omissions, and Variations across Different Manuscripts
<p>The analysis of textual variants of verses in the Ancient Greek New Testament across different manuscripts has mainly been done by close reading with manual effort. With the increasing number of transcriptions of the different manuscripts, quantitative analyses (so-called distant reading) can be used to search for patterns of omission, addition, or other variations, to formulate novel hypotheses to be investigated by close reading. In this work, we present a corpus of biblical names including spelling variation and inflections and their mentions in the transcriptions of the Ancient Greek New Testament.</p>
Additional deployments of the ALOHA Wirewalker dataset
<p>This dataset is an extension of the ALOHA Wirewalker dataset, available on Zenodo as (<a href="https://doi.org/10.5281/zenodo.3750468">https://doi.org/10.5281/zenodo.3750468</a>).</p><p>The dataset includes oceanographic observations collected by autonomous drifting profilers. For more information, please refer to the page of the original submission of the ALOHA Wirewalker dataset linked above.</p>
Additional steady-state simulations of Miocene Antarctic ice-sheet variability using 3D thermodynamical ice-sheet model IMAU-ICE
<div> </div> <div> <div> <div>We supplement our previous dataset (<a href="https://doi.pangaea.de/10.1594/PANGAEA.939114">doi:10.1594/PANGAEA.939114</a>), with six additional steady-state simulations of the Miocene Antarctic ice sheet using the reference Miocene settings.</div> <div> </div> <div>IMAU-ICE was run using a 40x40km grid covering the Antarctic continent. Initial conditions were obtained from reconstructions of the Antarctic bathymetry and bedrock topography pertaining to 23 to 24 million years (Myr) ago (dataset <a href="https://doi.pangaea.de/10.1594/PANGAEA.923109" target="_self">doi:10.1594/PANGAEA.923109</a>). The simulations were forced by climate input data obtained from GENESIS simulations with varying CO2 levels (280 to 840 ppm) and Antarctic ice sheet cover (no ice to a large East-Antarctic ice sheet), and with present-day insolation. We utilized a matrix interpolation method to construct the time-varying climate forcing, based on the prescribed CO2 levels and ice cover simulated by IMAU-ICE.</div> <div> </div> <div>For each simulation, we provide the run script, 1D output variables including CO2 level and the sea level contribution of the Antarctic ice sheet, and 3D output variables including ice thickness, bedrock and surface height, surface mass balance, basal mass balance, ice velocities, and ice temperatures. For more information, please contact L.B. Stap at l.b.stap@uu.nl.</div> </div> </div>
Effect of salinity on flows of dense colloidal suspensions - Additional Data
<p>Additional dataset for the article "Effect of salinity on flows of dense colloidal suspensions".</p>
Additional Data: Poised PABP-RNA hubs implement signal-dependent mRNA decay in development
<p>This repository contains processed data resulting from iCLIP experiments that were analysed in the following paper:"<strong>Poised PABP-RNA hubs implement signal-dependent mRNA decay in development</strong>"<br>The paper is published at Nature Structural and Molecular BIology.</p> <h2><br>Archived data</h2> <p>Data archived in this repository include:</p> <ol> <li>Data derived from iCLIP experiments targeting LIN28A, PABPC1, and PABPC4, that were analysed in the manuscript (see iCLIP.zip). Raw data is available from ENA, with the accession code PRJEB60519. <ol> <li>Sample descriptions are given in iCLIP-SampleAnnotation.csv</li> <li>Crosslink files in BED6 format (individual replicates and merged replicates)</li> <li>Peak files generated with the Clippy peak caller in BED6 format</li> <li>K-mer enrichment around high-confidence crosslink sites in the 3'-UTRs, calculated by the PEKA software</li> </ol> </li> <li>Expression values (salmon quantfiles) for 3'-seq experiments, specified in "QuantseqExperimentsAnnotation.tsv", are available in "SalmonQuantfiles.zip". Raw data is available from ENA, with the accession code PRJEB60519.</li> <li>Source code of the nextflow pipeline, which was used on the iMaps webserver to analyse iCLIP data and produce the files archived here (see imaps-nf-0.30.zip).</li> <li>A list of naive genes, that were analysed in the manuscript (see NaiveGeneIds.csv).</li> </ol> <h2>Details on iCLIP data generation</h2> <p>iCLIP data for LIN28A-WT (in 2iL and FGF2 treated cells), LIN28A-S200A (in FGF2 treated cells) as well as for PABPC1 and PABPC4 (in LIN28A KO cells with and without LIN28A overexpression), were analysed on iMaps Goodwright server (<a href="https://imaps.goodwright.com/">https://imaps.goodwright.com/</a>). The LIN28A iCLIPs were analysed on 18th of July, 2022; the PABPC iCLIPs were analysed on 26th of December, 2022. The code and settings used in the pipeline (release v0.30) can be viewed at <a href="https://github.com/goodwright/imaps-nf">https://github.com/goodwright/imaps-nf </a>, and is also archived here - (imaps-nf-0.30.zip)<br> </p> <ul> <li>First, reads were demultiplexed using Ultraplex and barcodes were trimmed from the reads. The default Ultraplex settings were applied, as denoted below:</li> </ul> <blockquote> <p>adapter='AGATCGGAAGAGCGGTTCAG'<br>adapter2='AGATCGGAAGAGCGTCGTG'<br>barcodes='barcode.csv',<br>final_min_length=20<br>fiveprimemismatches=1<br>ignore_no_match=False<br>ignore_space_warning=False<br>inputfastq='MOD4878A1-merged.fastq.gz',<br>keep_barcode=False,<br>min_trim=3,<br>outputprefix='demux',<br>phredquality=30,<br>phredquality_5_prime=0,<br>sbatchcompression=False,<br>threads=10,<br>threeprimemismatches=0,<br>ultra=False</p> </blockquote> <p> </p> <ul> <li>TrimGalore was used to run FASTQC and quality trim the reads and remove reads with length less than 10 nt:</li> </ul> <blockquote> <p>trim_galore --fastqc --length 10 -q 20 --cores 8 --gzip file.fastq.gz</p> </blockquote> <p> </p> <ul> <li>Reads were then premapped to rRNA, tRNA sequences referred to as small RNA, smRNA, using mouse genome build (GRCm39 GENCODE M28 annotation) with Bowtie v1.3.0 (Langmead et al., 2009)</li> </ul> <blockquote> <p>bowtie --threads 12 --sam -x $INDEX -q --un file.unmapped.fastq -v 2 -m 100 --norc --best --strata file.fq.gz 2</p> </blockquote> <p> </p> <ul> <li>Reads that did not map with Bowtie were then aligned with STAR v2.7.9a (Dobin et al., 2013) to mouse genome build (GRCm39 GENCODE M28 annotation).</li> </ul> <blockquote> <p>STAR \<br>--genomeDir star \<br>--readFilesIn file.unmapped.fastq.gz \<br>--runThreadN 12 \<br>--outFileNamePrefix 1_R1. \<br>\<br>--sjdbGTFfile Homo_sapiens_filtered.gtf \<br>--outSAMattrRGline 'ID:1_R1' 'SM:1_R1' \<br> --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --quantMode TranscriptomeSAM --outFilterMultimapNmax 1 --outFilterMultimapScoreRange 1 --outSAMattributes All --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterType BySJout --alignIntronMin 20 --alignIntronMax 1000000 --outFilterScoreMin 10 --alignEndsType Extend5pOfRead1 --twopassMode Basic</p> </blockquote> <p> </p> <ul> <li>PCR-duplicates were removed using UMI-tools (Smith, Heger and Sudbery, 2017)</li> </ul> <blockquote> <p>java -jar /UMICollapse/umicollapse.jar \<br> bam \<br> -i file.Aligned.sortedByCoord.out.bam \<br> -o file.dedup.bam \<br> --umi-sep rbc:</p> </blockquote> <p> </p> <ul> <li>The nucleotide preceding each sequencing read was assigned as the crosslink event.</li> </ul> <p> </p> <ul> <li>Peaks of crosslinking signal were identified with Clippy v1.4.1, using the default settings.</li> </ul> <p> </p> <ul> <li>Obtained peaks and crosslink sites were used to run PEKA v1.0.0 (Kuret et al., 2022), using the default settings.</li> </ul> <p> </p> <ul> <li>For Clippy and PEKA, the GENCODE primary assembly annotation M28 was filtered to retain only entries with transcript support level 1 or 2, in genes where such transcripts were available, and used to produce a segmentation file with the <em>get_segments</em> function from the iCount tool (Curk, 2019).</li> </ul> <p> </p> <ul> <li>All files generated during data processing are available from the iMaps Goodwright webserver for analysis of CLIP data (see <a href="https://imaps.goodwright.com/collections/882635250203/">https://imaps.goodwright.com/collections/882635250203/</a> and <a href="https://imaps.goodwright.com/collections/340215254997/">https://imaps.goodwright.com/collections/340215254997/</a> for LIN28A and PABPC1/4 iCLIPs, respectively).</li> </ul> <h2>Source data</h2> <p>Raw sequencing reads, from which the data enclosed here were derived, are accessible at ENA (PRJEB60519).<br>The raw sequencing reads and all data produced by the analysis pipeline is also available at the iMaps webserver (see <a href="https://imaps.goodwright.com/collections/882635250203/">https://imaps.goodwright.com/collections/882635250203/</a> and <a href="https://imaps.goodwright.com/collections/340215254997/">https://imaps.goodwright.com/collections/340215254997/</a> for LIN28A and PABPC1/4 iCLIPs, respectively); and on the updated Flow webserver (see <a href="https://app.flow.bio/projects/882635250203/">https://app.flow.bio/projects/882635250203/</a> and <a href="https://app.flow.bio/projects/340215254997/">https://app.flow.bio/projects/340215254997/ </a>for LIN28A and PABPC1/4 iCLIPs, respectively).</p> <h2>Downstream computational analysis of enclosed data</h2> <p>The code, used to analyse the data enclosed here and train the CNN to predict transcript stability in naive-to-primed transition based on 3'UTR nucleotide sequence, is available at GitHub (<a href="https://github.com/ulelab/LIN28A_RNPreassembly_bioinformatics">https://github.com/ulelab/LIN28A_RNPreassembly_bioinformatics</a>) and archived on Zenodo (<a href="../doi/10.5281/zenodo.10054297">https://zenodo.org/doi/10.5281/zenodo.10054297</a><strong>).</strong></p>
Additional Artifacts - Supplements to: A Resilient Workflow to Control a Biomedical HPC Simulation in an Urgent Computing Setting
<p>In this dataset, we have collected supplementary artifacts to support an understanding of the workflow presented in the submission cited (see related identifiers).</p> <p>These artifacts are (cf. README.md in the main folder of the tar.gz archive):</p> <p>A1: modified HemoFlow code (cf. https://github.com/gzavo/hemoflow) for our workflow experiments (subfolder "hemoflowcfd");<br>A2: workflow descriptions in python for Apache Airflow (subfolder "workflow");<br>A3: inputs (.xml/.npz) and output (.txt) for the example (subfolder "case").</p> <p> </p>
Additional Phase Space Files of a Liac HWL linac
<p>Additional phase-space files (PSFs) calculated with <em>penEasy 2020</em> for the Liac HWL mobile accelerator (S.I.T.). This record complements the original record <a href="https://doi.org/10.5281/zenodo.14029134">https://doi.org/10.5281/zenodo.14029134</a> with the applicator diameters of 7, 9 and 12 cm.</p> <p><em>C7B0_12MeV</em> stands for applicator with a diameter of 7 cm, a 0º bevel ending and simulated with a beam energy of 12 MeV.</p> <p>NOTE: To recreate a realistic setup, the simulation should include a PMMA cylindrical applicator with the selected inner diameter and a wall thickness of 0.5 cm. This PSFs can be rotated to simulate beveled applicators.</p> <p>All files are provided in the IAEA PHSP format, including the corresponding header files, making them compatible with most Monte Carlo codes for radiation transport simulation.</p>
Additional data: Longitudinal single-cell multiomic atlas of high-risk neuroblastoma reveals chemotherapy-induced tumor microenvironment rewiring
<p>This repository provides additional data for the manuscript titled "Longitudinal single-cell multiomic atlas of high-risk neuroblastoma reveals chemotherapy-induced tumor microenvironment rewiring", currently under revision at Nature Genetics. The primary data cohort has been deposited in the HTAN data portal. This repository includes processed 10x Xenium spatial transcriptomic data for six TH-MYCN mice (three chemotherapy-treated and three treatment-naive) as well as processed scRNA-seq data for CHLA15 and CHLA20 neuroblastoma (NBL) cells. The scRNA-seq data includes mono-cultured, co-cultured cells with THP-1 macrophages, and co-culture cells treated with Afatinib/CRM197. </p>
Additional Data - Phototoxicity induced in living HeLa cells by focused femtosecond laser pulses
<p>Nonlinear optical microscopy is a powerful label-free imaging technology, providing biochem-ical and structural information in living cells and tissues. A possible drawback is photodamageinduced by high-power ultrashort laser pulses. Here we present an experimental study on thou-sands of HeLa cells, to characterize the damage induced by focused femtosecond near-infraredlaser pulses as a function of laser power, scanning speed and exposure time, in both wide-field andpoint-scanning illumination configurations. Our data-driven approach offers an interpretation ofthe underlying damage mechanisms and provides a predictive model that estimates its probabilityand extension and a safety limit for the working conditions in nonlinear optical microscopy. Inparticular, we demonstrate that cells can withstand high temperatures for a short amount of time,while they die if exposed for longer times to mild temperatures. It is thus better to illuminatethe samples with high irradiances: thanks to the nonlinear imaging mechanism, much strongersignals will be generated, enabling fast imaging and thus avoiding sample photodamage.</p>
Data & R-Code for "Weather and food availability additively affect reproductive output in an expanding raptor population"
<p><strong>Abstract</strong></p> <p>The joint effects of interacting environmental factors on key demographic parameters can exacerbate or mitigate the separate factors’ effects on population dynamics. Given ongoing changes in climate and land use, assessing interactions between weather and food availability on reproductive performance is crucial to understand and forecast population dynamics. By conducting a feeding experiment in 4 years with different weather conditions, we were able to disentangle the effects of weather, food availability and their interactions on reproductive parameters in an expanding population of the red kite (<em>Milvus milvus</em>), a conservation-relevant raptor known to be supported by anthropogenic feeding. Brood loss occurred mainly during the incubation phase, and was associated with rainfall and low food availability. In contrast, brood loss during the nestling phase occurred mostly due to low temperatures. Survival of last-hatched nestlings and nestling development was enhanced by food supplementation and reduced by adverse weather conditions. However, we found no support for interactive effects of weather and food availability, suggesting that these factors affect reproduction of red kites additively. The results not only suggest that food-weather interactions are prevented by parental life-history trade-offs, but that food availability and weather conditions are crucial separate determinants of reproductive output, and thus population productivity. Overall, our results suggest that the observed increase in spring temperatures and enhanced anthropogenic food resources have contributed to the elevational expansion and the growth of the study population during the last decades.</p>
Fabrication of a Soft Robotic Gripper With Integrated Strain Sensing Elements Using Multi-Material Additive Manufacturing
<p>With the purpose of making soft robotic structures with embedded sensors, additive manufacturing techniques like fused deposition modeling (FDM) are popular. Thermoplastic polyurethane (TPU) filaments, with and without conductive fillers, are now commercially available. However, conventional FDM still has some limitations because of the marginal compatibility with soft materials. Material selection criteria for the available material options for FDM have not been established. In this study, an open-source soft robotic gripper design has been used to evaluate the FDM printing of TPU structures with integrated strain sensing elements in order to provide some guidelines for the material selection when an elastomer and a soft piezoresistive sensor are combined. Such soft grippers, with integrated strain sensing elements, were successfully printed using a multi-material FDM 3D printer. Characterization of the integrated piezoresistive sensor function, using dynamic tensile testing, revealed that the sensors exhibited good linearity up to 30% strain, which was sufficient for the deformation range of the selected gripper structure. Grippers produced using four different TPU materials were used to investigate the effect of the Shore hardness of the TPU on the piezoresistive sensor properties. The results indicated that the <em>in situ</em> printed strain sensing elements on the soft gripper were able to detect the deformation of the structure when the tentacles of the gripper were open or closed. The sensor signal could differentiate between the picking of small or big objects and when an obstacle prevented the tentacles from opening. Interestingly, the sensors embedded in the tentacles exhibited good reproducibility and linearity, and the sensitivity of the sensor response changed with the Shore hardness of the gripper. Correlation between TPU Shore hardness, used for the gripper body and sensitivity of the integrated <em>in situ</em> strain sensing elements, showed that material selection affects the sensor signal significantly.</p>
A soft pneumatic actuator with integrated deformation sensing elements produced exclusively with extrusion based additive manufacturing
<p>In recent years, soft pneumatic actuators have come into the spotlight because of their simple control and the wide range of complex motions. To monitor the deformation of soft robotic systems, elastomer-based sensors are being used. However, the embedding of sensors into soft actuator modules by polymer casting is time consuming and difficult to upscale. In this study, it is shown how a pneumatic bending actuator with an integrated sensing element can be produced using an extrusion-based additive manufacturing method, e.g., fused deposition modeling (FDM). The advantage of FDM against direct printing or robocasting is the significantly higher resolution and the ability to print large objectives in a short amount of time. New, commercial launched, pellet-based FDM printers are able to 3D print thermoplastic elastomers of low shore hardness that are required for soft robotic applications, to avoid high pressure for activation. A soft pneumatic actuator with the in situ integrated piezoresistive sensor element was successfully printed using a commercial styrene-based thermoplastic elastomer (TPS) and a developed TPS/carbon black (CB) sensor composite. It has been demonstrated that the integrated sensing elements could monitor the deformation of the pneumatic soft robotic actuator. The findings of this study contribute to extending the applicability of additive manufacturing for integrated soft sensors in large soft robotic systems.</p>
Effect of MgO sintering additive on mullite structures manufactured by fused deposition modeling (FDM) technology
<p>An optimized recipe for 3D printing of Mullite-based structures was used to investigate the effect of MgO sintering additive on the processing stages and final ceramic properties. To achieve dense 3:2 mullite, ceramic filaments were prepared based on an alumina powder, a methyl silicone resin, EVA elastomeric binder and MgO powder. Using 1 wt% MgO and a dwell time of 5 h at 1600 °C, a dense mullite structure could be obtained from filaments with a diameter of 1.75 mm. Ceramic structures with and without sintering additive were printed in vertical and horizontal direction, to investigate the effect of printing direction on mechanical strength after sintering. Using four-point bending test, it was demonstrated that by using MgO, the printing orientation did not affect the mechanical strength significantly anymore. The low Weibull modulus could be explained by the closed porosity that emerge during the degassing of the preceramic polymer due to cross-linking.</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.