Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
103
datasets available to search
ShareScore release 0.9.0
Dataset results
103 results for “reference database”
16S and ITS Reference Annotation Databases
<p>Unite is a mirror of Unite 7.2 mothur release.</p> <p>Silvamod and GreenGenes datasets represent a mirror of the extracted data files used for:</p> <blockquote> <p>Lanzén A , Jørgensen SL, Huson D, Gorfer M, Grindhaug SH, Jonassen I, Øvreås L, Urich T (2012) CREST - Classification Resources for Environmental Sequence Tags, <em>PLoS ONE</em> <strong>7</strong>:e49334</p> </blockquote>
ATLAS reference databases
<p>Pre-formatted databases for use with ATLAS assembly and annotation protocol.</p>
rpsC reference database for xander
<p>Reference gene database (<em>rpsC</em>) for Xander (https://github.com/rdpstaff/Xander_assembler).</p>
CID2013: A Database for Evaluating No-Reference Image Quality Assessment Algorithms
<p>The CID2013 Camera Image Database consists of real images taken by consumer cameras and mobile phones. It is developed to provide useful tool to allow researchers target more commercially relevant distortions when developing processes of objective image quality assessment algorithms.</p> <p>The CID2013 database consists of 480 evaluated images captured by 79 imaging devices (mobile phones, DSC, DSLR) in six Image Sets. Note that the actual number of images in the database is 474. In Image Set II, Device 6 is evaluated twice as we wanted to test inter-observer reliablity. The scores are later combined into a single MOS value as the two evaluations correlated strongly.</p> <p>If you use this database in your research, we kindly ask that you follow the copyright notice bellow and cite the following paper:</p> <p>Virtanen, T., Nuutinen, M., Vaahteranoksa, M., Oittinen, P. and Häkkinen, J. “CID2013: a database for evaluating no-reference image quality assessment algorithms”, IEEE Transactions on Image Processing, vol. 24, no. 1, pp. 390-402, Jan. 2015. <a href="http://ieeexplore.ieee.org/xpl/articleDetails.jsp?arnumber=6975172">[pdf]</a></p> <p><strong>Method</strong></p> <p>The images are evaluated by 188 observers using Dynamic Reference (DR-ACR) method (explained below). A separate scale realignment ACR data consisting evaluations from 34 observers is also included that allows to combine the data from the six image sets</p> <p>In other respects the DR-ACR method resembles very much a basic Absolute Category Rating (ACR) method (ITU-R 500-11), except the observers saw a slideshow of all the other images in the test depicting the same scene before every evaluation (See DR_demo.mp4). By seeing the other images in the test setup as reference the observers were more aware of the total variation of quality represented within a single image set. This improved their evaluation as they didn’t need to save the far ends of the scale in case there would be even more better or worse image later on the experiment. The DR-ACR method is explained in detail in:</p> <p>Mikko Nuutinen, Toni Virtanen, Tuomas Leisti, Terhi Mustonen, Jenni Radun, Jukka Häkkinen (2014) A new method for evaluating the subjective image quality of photographs : dynamic reference Multimedia Tools and Applications 75: 4. 2367-2391 Dec.</p> <p>Database contains consumer camera images and their subjective evaluations in mean opinion score (MOS), sharpness, graininess, lightness and color saturation scales. It includes the complete raw data and background information from the naïve observers used to evaluate the images. Subjects’ vision was controlled for the near visual acuity, near contrast vision (near F.A.C.T.) and color vision (Farnsworth D15) before the participation. They received movie tickets as a reward. Outlier removal is made for mean opinion score (MOS) evaluations using ITU-R 500-11 recommendations to ease out the implementation of the database.</p> <p><strong>Material</strong></p> <p>The images in CID2013 are intended to represent typical photographs that consumers might capture with their cameras. The photographed scenes were based partly on the Photospace approach described by I3A (CPIQ Initiative Phase 1 White Paper: Fundamentals and review of considered test methods, I3A, 2007) The I3A CPIQ project has migrated under IEEE.</p> <p><strong>The test environment</strong></p> <p>The room has been covered with medium gray curtains to diffuse the ambient illumination. Fluorescent lights (5800K) were positioned behind the monitors and reflected from the back wall covered with grey curtain to create dim and uniform ambient illumination in the room. The light hitting the monitors measured below 20 lx. The subject’s viewing distance (approximately 80 cm) was controlled by a line hanging from the ceiling, and they were instructed to keep their forehead steady next to the line. Because of the display size, images were scaled to a size of 1600 x 1200 pixels using the bicubic interpolation method. Eizo ColorEdge CG241W, with 1920x1200 pixel resolution, monitors in was calibrated to sRGB having target values of: 80 cd/m2, 6500K and gamma 2.2 using EyeOne Pro calibrator (X-rite co.).</p> <p> </p> <p>-----------COPYRIGHT NOTICE STARTS WITH THIS LINE------------</p> <p>Copyright (c) 2014 The University of Helsinki<br> All rights reserved.</p> <p>Permission is hereby granted, without written agreement and without license or royalty fees, to use, copy, modify, and distribute this database (the videos, the images, the results and the source files) and its documentation for any purpose, provided that the copyright notice in its entirely appear in all copies of this database, and the original source of this database,Visual Cognition research group (www.helsinki.fi/psychology/groups/visualcognition/index.htm) and the Institute of Behavioral Science (www.helsinki.fi/ibs/index.html) at the University Helsinki (www.helsinki.fi/university/), is acknowledged in any publication that reports research using this database. Individual videos and images may not be used outside the scope of this database (e.g. in marketing purposes) without prior permission.</p> <p>The database and our paper are to be cited in the bibliography as:</p> <p>-----------------------------------------------------------------------------<br> Virtanen, T., Nuutinen, M., Vaahteranoksa, M., Oittinen, P. and Häkkinen, J. “CID2013: a database for evaluating no-reference image quality assessment algorithms”, IEEE Transactions on Image Processing, 2014, In press.<br> -----------------------------------------------------------------------------</p> <p>LIMITATION OF LIABILITY</p> <p>UNIVERSITY OF HELSINKI SHALL IN NO CASE BE LIABLE IN CONTRACT, TORT OR OTHERWISE FOR ANY LOSS OF REVENUE, PROFIT, BUSINESS OR GOODWILL OR ANY DIRECT, INDIRECT, SPECIAL, CONSEQUENTIAL, INCIDENTAL OR PUNITIVE COST, DAMAGES OR EXPENSE OF ANY KIND HOWEVER CAUSED OR HOWEVER ARISING UNDER OR IN CONNECTION WITH THE USE OF THIS DATABASE.</p> <p>THE UNIVERSITY OF HELSINKI SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE DATABASE PROVIDED HEREUNDER IS ON AN "AS IS" BASIS, AND THE UNIVERSITY OF HELSINKI HAS NO OBLIGATION TO PROVIDE MAINTENANCE, SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS.</p> <p>THIS AGREEMENT SHALL BE CONSTRUED AND INTERPRETED IN ACCORDANCE WITH THE LAWS OF FINLAND, EXCLUDING ITS RULES FOR CHOICE OF LAW.</p> <p>-----------COPYRIGHT NOTICE ENDS WITH THIS LINE------------</p> <p> </p>
Creating, curating, and evaluating a mitogenomic reference database to improve regional species identification using environmental DNA
<p><span>Species detection using eDNA is revolutionizing global capacity to monitor biodiversity. However, the lack of regional, vouchered, genomic sequence information—especially sequence information that includes intraspecific variation—creates a bottleneck for management agencies wanting to harness the complete power of eDNA to monitor taxa and implement eDNA analyses. eDNA studies depend upon regional databases of mitogenomic sequence information to evaluate the effectiveness of such data to detect and identify taxa. We created the Oregon Biodiversity Genome Project to create a database of complete, nearly error-free mitogenomic sequences for all of Oregon's fishes. We have successfully assembled the complete mitogenomes of 313 specimens of freshwater, anadromous, and estuarine fishes representing 24 families, 55 genera, and 129 </span><span>species and lineages. Comparative analyses of these sequences illustrate that many regions of the mitogenome are taxonomically informative, that the short (~150 bp) mitochondrial "barcode" regions typically used for eDNA assays do not consistently diagnose for species, and that complete single or multiple genes of the mitogenome are preferable for identifying Oregon's fishes. This project provides a blueprint for other researchers to follow as they build regional databases, illustrates the taxonomic value and limits of complete mitogenomic sequences, and offers clues as to how current eDNA assays and environmental genomics methods of the future can best leverage this information.</span></p>
Creating, curating, and evaluating a mitogenomic reference database to improve regional species identification using environmental DNA
Open the record for dataset details and reuse information.
Transitioning from environmental genetics to genomics using mitogenome reference databases
Open the record for dataset details and reuse information.
Reference Windfarm database PDk 90
<p>Dataset for TotalControl reference windfarm database simulation of a pressure-driven high Reynolds number boundary layer flow with 90 degree inflow wind direction angle (Casename PDk 90)</p> <p>Included Python files for loading and visualizing the data. Use the plot_*.py files.</p> <p>Further information, including description of the case and dataset can be found in the deliverable report at: </p> <p><a href="https://cordis.europa.eu/project/id/727680/results">https://cordis.europa.eu/project/id/727680/results</a></p> <p>"Database for reference wind farms part 2: windfarm simulations"</p>
Reference Windfarm database PDkhi 0
<p>Dataset for TotalControl reference windfarm database simulation of a pressure-driven high Reynolds number boundary layer flow with 0 degree inflow wind direction angle (Casename PDkhi 0)</p> <p>Included Python files for loading and visualizing the data. Use the plot_*.py files.</p> <p>Further information, including description of the case and dataset can be found in the deliverable report at: </p> <p><a href="https://cordis.europa.eu/project/id/727680/results">https://cordis.europa.eu/project/id/727680/results</a></p> <p>"Database for reference wind farms part 2: windfarm simulations"</p>
Reference Windfarm database CNk8 90
<p>Dataset for TotalControl reference windfarm database simulation of a conventionally neutral boundary layer flow with 90 degree inflow wind direction angle (Casename CNk8 90)</p> <p>Included Python files for loading and visualizing the data. Use the plot_*.py files.</p> <p>Further information, including description of the case and dataset can be found in the deliverable report at: </p> <p><a href="https://cordis.europa.eu/project/id/727680/results">https://cordis.europa.eu/project/id/727680/results</a></p> <p>"Database for reference wind farms part 2: windfarm simulations"</p>
RVDB-prot, a reference viral protein database and its HMM profiles
<p>We present RVDB-prot, a database corresponding to the protein equivalent of the nucleic acid reference virus database RVDB. Protein databases can be helpful to perform more sensitive protein sequence comparisons. Similarly to its homologous public repository, RVDB-prot aims to provide reliable and accurately annotated unique entries, while including also an Hidden Markov Model (HMM) protein profiles database for distant protein searching.</p>
V9_DeepSea (Deep Sea Reference Database)
<p>Deep Sea reference database for benthic protist communities: For the taxonomic assignment of our deep-sea sediment sample sequences, we used a reference database called V9_DeepSea. Besides V9 sequences from the Protist Ribosomal Reference database PR2 v4.11.1, we included 102 in-house Sanger-sequenced strains of which the majority was isolated from deep-sea (57 strains) and marine surface waters (32 strains).</p>
Database of conference proceedings references corresponding to Eimeria species that infect ruminants
<p>Database of conference proceedings references corresponding to Eimeria species that infect ruminants</p>
Database on 16 reinforced concrete walls with lap splices and 8 reference units with continuous reinforcement (V2 models included)
<p>Recent post-earthquake missions have shown that both old and code-compliant reinforced concrete wall buildings can experience critical damage due to lap splices, which led to a recent surge in experimental tests of walls with such constructional detail. Most of the 16 walls with lap splices described in the literature thus far were carried out in the last five years. A database with these wall tests, plus 8 reference unit walls with continuous reinforcement, is herein provided alongside with the shell element models developed in Vector2 to simulate their inelastic F-D response</p> <p><strong>If the experimental data or the models are used, please cite:</strong></p> <p>- J.P. Almeida, O. Prodan, D. Tarquini, K. Beyer, 2017. "<em>Influence of lap-splices on the cyclic inelastic response of<br> reinforced concrete walls. I: Database assembly, recent experimental data, and findings for model development</em>", ASCE<br> Journal of Structural Engineering 143 (12), DOI: 10.1061/(ASCE)ST.1943-541X.0001853.</p> <p>- D. Tarquini, J.P. Almeida, O. K. Beyer, 2017. <em>"Influence of lap-splices on the cyclic inelastic response of reinforced<br> concrete walls. II: Shell element simulation and equivalent uniaxial model</em>", ASCE Journal of Structural Engineering 143<br> (12), DOI: 10.1061/(ASCE)ST.1943-541X.0001859.</p>
Insect COI reference database
<p>Insect and arachnid COI reference database, trimmed to the regions amplified by the primers BF1-BR1</p> <p>This repository includes a fasta file, a trained IDTAXA database, and a PHMM model.</p>
TA B L E 2 Identified R packages useful for taxonomic name harmonization. Square brackets indicate supplementary references in Harmonizing taxon names in biodiversity data: A review of tools, databases and best practices
TA B L E 2 Identified R packages useful for taxonomic name harmonization. Square brackets indicate supplementary references
rCRUX Generated rbcl (Plant RBCL7/8) Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: rbcl (Plant RBCL7/8)<br> Gene: rbcl<br> Length of Target: 180<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 150<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA<br> Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC<br> Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Summary table and references of studies of the biogeography of the West Indies found in the Web of Science Core Collection database
Open the record for dataset details and reuse information.
Genotype reference database (GRDB) for Alouatta caraya
<p>The black and gold howler monkey (<em>Alouatta caraya</em>) is a neotropical primate that faces the highest capture pressure for illegal trade in Argentina. Here, present a Genotype reference database (GRDB) this species. Overall, we were able to correctly assign 73% of the individuals in the database to nearest population of origin, and 93.3% to their cluster of origin. </p>
Supplementary data (low-diversity metagenome and reference database completeness) to accompany "phyloFlash – Rapid SSU rRNA profiling and targeted assembly from metagenomes"
<p>Comparison of phyloFlash and Matam on low-diversity platyhelminth metagenome, showing effect of reference database completeness on results. </p> <p>The phyloFlash software is available from https://github.com/HRGV/phyloFlash. Examples were generated with phyloFlash v3.3b.</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.