Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

1,287

datasets available to search

ShareScore release 0.7.1

Reset

Dataset results

1,287 results for “species identity”

Learn how ShareScore rates datasets ↗
dryad32/100

Data from: Movement ecology of Afrotropical birds: Functional traits provide complementary insights to species identity

Effects of anthropogenic activities on habitats and species communities and populations are complex and vary across species depending on their ecological traits. Movement ecology may provide important insights into species´ responses to habitat structures and quality. We investigated how movement behavior across a human-modified landscape depends on species identity and species traits, with particular focus on habitat specialization, feeding guilds and dispersal behavior. We tracked 34 individuals of nine Afrotropical bird species during three years in an anthropogenic riparian landscape of East Africa. We investigated whether species' functional traits predicted their habitat use and movement behavior better than species´ identities. Our results indicate that habitat specialists mainly occur in dense riparian thickets, while habitat generalists do occur in agricultural land. Home-ranges of omnivorous habitat generalists are larger than of frugivorous and insectivorous generalists and omnivorous and insectivorous specialists. Movement speed was highest in settlement areas for all species, with activity peaks during morning and afternoon for habitat specialists. Our results reveal that functional traits and species identity provide complementary insights into responses of organisms to habitat structures and habitat quality.

opencc-zeroSep 2019View details →
zenodo32/100

FIGURE 59. ITS2 sequence alignment for putative species sequenced here. Where identical ITS2 in Cardicola Short, 1953 and Braya n. gen. Digenea: Sanguinicolidae) from five families of tropical Indo-Pacific fishes (

FIGURE 59. ITS2 sequence alignment for putative species sequenced here. Where identical ITS2 sequences were obtained from sanguinicolids of different host/location combinations (not differentiated by morphological comparisons) only one representative sequence has been included here. Gaps of five spaces delineate the 5' and 3' ends of ITS2 (and subsequent 3' end of 5.8S and the 5' end of 28S).

opennotspecifiedJul 2006View details →
zenodo32/100

PLATE 2 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 2. Serrasalmus manueli (10) and S. gouldingi (11–15). (Photographs of S. gouldingi specimens 12 and 14 by Donald Taphorn.)

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 7 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 7. Phylogenetic trees of serrasalmids inferred from ribosomal (A) and control region (B) data sets, both including original material and GenBank sequences. Parsimony bootstrap percentages are shown above branch nodes, while proportions (>50%) of trees possessing a given clade in Bayesian posterior distributions are shown below. Taxa shared by both trees are in bold font. Specimen sequences from original material appear in shadow boxes, preceding numbers (1-33) correspond to numbered specimens and information presented in Table 1 and elsewhere. GenBank sequences are followed by gb. Taxa with VNTR in control region marked by an "R" and reconstruction of presence of VNTR shown in blue. GenBank (gb) species with asterisk (*) indicate taxa of which we question the identification.

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 6. Primers used for amplifying and sequencing the control region and adjacent tRNAs. Internal primers 5'-3': 662F – ACCATGCCAAGGCGTTCTTT, 662R – AAAGAACGCCTTGGCATGGT, 724F – ACATTTGGTCACTTTCG- GAGA, 462R – CGGTTGGTGGTCTCTTACTACA, F-TTF2 – CGCCACCAGAAAAGAGAGAT, and F-12R2 - GCCCGTGGAACTTTCTAGG

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 5 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 5. Serrasalmus irritans (24), Pygocentrus cariba (25), and Pygopristis denticulatus (27). (No photograph or voucher available for specimen 26.)

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 1. Alternative hypotheses of serrasalmid relationships: (A) Machado-Allison (1983, 1985), based on morphology, divides family into two major clades; (B) Machado-Allison et al. (1989) revised piranha clade showing the position of Pristobrycon striolatus if absence of pre-anal spine is considered to be primitive character (arrow indicates occurrence of this trait); (C) Ortí et al. (1996), based on mitochondrial ribosomal RNA sequence data, defines three major clades. Upper tree includes 13 of the currently 15 recognized genera, lower tree includes 11 genera. Note: the genus Tometes was presented in original tree of Ortí et al. (1996) as "N. gen. A" (P. Petry, pers. comm. 2005). The authors also stated that specimens assigned by Machado-Allison (1982, 1983) to Utiaritichthys do not belong to that genus, apparently suggesting the specimens are Tometes.

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 6. Pristobrycon striolatus (28–31) and additional small juvenile specimens collected with genetic vouchers showing life colors.

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 3 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 3. Diet and intestinal length data mapped onto Machado-Allison's (1985) proposed phylogeny (modified from Nico 1991). Diet data based on 18 serrasalmid species from the Orinoco River basin (Venezuela); number in parentheses following generic name represents numbers of species in each genus included in study; Jv = juvenile trait; ad = adult trait; long intestine defined as mean intestine length>1.2 X standard length.

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 1. Serrasalmus manueli (1–9). (No photograph or voucher available for specimen 3.) (Photograph of 8-S. manueli by Frank Pezold.)

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 5 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 5. Adult and juvenile specimens of Serrasalmus gouldingi (A and B) and S. manueli (C and D) from southern Venezuela. Adult specimens (upper frame) are 195 and 240 mm SL; juvenile specimens (lower frame) are both 65 mm SL. Museum catalogue numbers for A-D: UF 148231, UF 120211, UF 121513, and UF 81180.

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 2 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 2. Van Every and Kritsky (1992) hypothesis of the evolutionary relationships of 10 piranha species from the central Amazon based on their helminth (Anacanthorus) parasite fauna.

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 4 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 4. Map of northern South America showing collection sites of Serrasalmus manueli (triangles), S. gouldingi (circles), and Serrasalmus sp. "A" (diamond). Symbols may represent more than one collecting locality. Solid red symbols represent capture sites for material used in present genetic study (Maps A and B); numbers pertain to individual specimens, S. manueli (1-10), S. gouldingi (11-16), and Serrasalmus sp. "A" (17) (see Table 1). Hollow symbols on Map A are based on museum records and published information (specimen identities and capture localities were not verified for all records). Stars represent type localities for S. manueli (Pr, Rio Parguaza) and S. gouldingi (lower Rio Negro). Principal rivers: A, Amazon; B, Branco; C, Casiquiare; G-N, Guainia-Negro; J, Japurá; N, Negro; R, Orinoco; and S-A, Solimões. Other rivers: Ar, Arirará; Ca, Capanaparo; Ci, Cinaruco; Cu, Cunucunuma; Cv, Cuchiverio; D, Daraá; G, Guaypo-Sipapo; P, Pasimoni; Pr, Parguaza; Sb, San Bartolo (Guariquito system); Si, Siapa; T, Atabapo-Atacavi; and V, Ventuari.

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 7 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 7. Piaractus brachypomus (33) (Photograph provided by Robert Lea). (No photograph or voucher available for specimen 32.)

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 8 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 8. Phylogram of combined ribosomal and control region sequences. Analysis includes specimens appearing in bold font in Figure 7. Proportion of trees from posterior distribution possessing a given clade below branch, parsimony bootstrap proportions (>50%) above branch. Specimen sequences from original material appear in shadow boxes, associated number in parentheses (1–33) correspond to numbered specimens and information presented in Table 1 and elsewhere. GenBank sequences are followed by gb. Arrow marks branches with lengths that were not significantly different from zero. GenBank (gb) species with asterisk (*) indicate taxa of which we question the identification.

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 4 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 4. Serrasalmus medinai (20) and S. irritans (21–23). (Photograph of live 20-S. medinai by Noel Burkhead.)

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 3 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 3. Serrasalmus gouldingi (16), Serrasalmus sp. A (17), and S. medinai (18–19). Images of Serrasalmus sp. "A" are of specimen 17 (originally captured in 1991) at different ages, including the same fish live in captivity photographed in 1993 (as juvenile about 2+ years old), 2006, and after preservation in 2007.

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURES 1–5. 1–3 in The identity of Agrilus impexus Horn, a new species, and taxonomic notes and records for other Agrilus Curtis species (Coleoptera: Buprestidae)

FIGURES 1–5. 1–3, Genitalia of male Agrilus: 1. A. impexus (New Mexico, Jemez Springs, CASC); 2. A. paraimpexus (Holotype); 3. A. addendus (Texas, Rocksprings, CHAH), scale bar indicates 1.0 mm; 4–5, Agrilus funestus Chevrolat: 4. dorsal habitus and lateral habitus (Texas specimen), scale bar indicates 2.0 mm; 5. genitalia of male (specimen from Mexico, Chiapas, 2 mi NNW Pueblo Nuevo, LLU Biol. Sta., 12.07.1965, G.H. Nelson, FSCA), scale bar indicates 1.0 mm.

opennotspecifiedOct 2007View details →
zenodo32/100

FIGURES 49–53. Lanka sahyadriensis. 49 in The flea beetle genus Lanka (Coleoptera: Chrysomelidae) in India with descriptions of three new species and notes on the identity of the pollu beetle infesting black pepper, Piper nigrum

FIGURES 49–53. Lanka sahyadriensis. 49. vaginal palpi; 50. spermatheca (specimen from Naduvattam); 51. spermatheca (specimen from Karnataka); 52. spermatheca (specimen from Doddabetta Valley); 53. tignum.

opennotspecifiedJan 2008View details →
zenodo32/100

FIGURES 39–48. Lanka sahyadriensis. 39 in The flea beetle genus Lanka (Coleoptera: Chrysomelidae) in India with descriptions of three new species and notes on the identity of the pollu beetle infesting black pepper, Piper nigrum

FIGURES 39–48. Lanka sahyadriensis. 39. intercoxal ridges on first abdominal ventrite; 40. male last abdominal ventrite; 41. aedeagus of holotype, ventral view; 42. same, lateral view; 43. same, distal opening; 44. tegmen; 45–48. aedeagus, variation in shape.

opennotspecifiedJan 2008View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record