Find research datasets worth reusing

Fig. 7 in Not withering on the evolutionary vine: systematic revision of the Brown Vine Snake (Reptilia: Squamata: Oxybelis) from its northern distribution

Fig. 7 Specimen of O. aeneus (FMNH 64417) from Manaus, Amazonas, Brazil. This specimen was collected c. 518 km from the type locality

Fig. 4 in Not withering on the evolutionary vine: systematic revision of the Brown Vine Snake (Reptilia: Squamata: Oxybelis) from its northern distribution

Fig. 4 Plot of discrimination analysis of sixteen morphological characters, showing clustering among geographically defined groups. Colors represent specimens from Central America (CA, orange), Central Brazil (CB, black stars), Eastern Mexico (EM, blue), northern South America (NSA, purple), Panama (P, yellow), and western region (WR, green). Colors correspond to those in Fig. 3

Fig. 5 in Not withering on the evolutionary vine: systematic revision of the Brown Vine Snake (Reptilia: Squamata: Oxybelis) from its northern distribution

Fig. 5 Phylogenetic estimate of relationships within Oxybelis estimated from a Bayesian 50% majority-rule consensus phylogram using a multilocus dataset (cyt b, ND4, 12S, 16S, cmos and PRLR; total of 3663 bp) with posterior probabilities (≥ 95) represented at the node (red circles). Values adjacent to nodes represent additional support values (SH-aLRT> 80% and UFboot> 95%) from maximum likelihood (ML)

Fig. 2 in Not withering on the evolutionary vine: systematic revision of the Brown Vine Snake (Reptilia: Squamata: Oxybelis) from its northern distribution

Fig. 2 Image showing the variability in snout shape among populations of Oxybelis aeneus. a A slender taper from the occipital region to rostral scale (UAZ 16787, Arizona, USA); b tapered, but snout in front of eyes is slightly constricted (FMNH 64417, Brazil); c a taper from the occipital region but the area in front of the eyes is broad and the rostal is rounded (UIMNH 25069, San Luis Potosí, Mexico)

Fig. 3 in Not withering on the evolutionary vine: systematic revision of the Brown Vine Snake (Reptilia: Squamata: Oxybelis) from its northern distribution

Fig. 3 Localities from which we obtained tissues for molecular work, other than the type locality represented by a black circle. Colors represent tissues of brown vine snakes from Central America (orange), Eastern Mexico (light blue), Panama (yellow), northern South America (purple), and the western region (light green); other taxa with molecular data represented are O. brevirostris (dark green), O. fulgidus (gray and

Fig. 1 in Not withering on the evolutionary vine: systematic revision of the Brown Vine Snake (Reptilia: Squamata: Oxybelis) from its northern distribution

Fig. 1 In life photographs of Oxybelis aeneus (sensu Keiser 1974) from throughout its distribution showing tremendous morphological variation. a Reserva Amazonica, Peru (W.E. Duellman); b Santa Rosa, Costa Rica (L. Porras); c Venezuela (D.A. Briceño C.); d Jalapão, Tocantins, Brazil (LJV). Photos a and d show a gaping mouth that is a typical defense behavior for members of the Oxybelis aeneus complex

FIGURE 2. Bayesian majority rule consensus tree inferred from the plastid DNA trnL-F in Evolutionary history of the tribe Astereae in the Flora Iranica area: Systematic implications

FIGURE 2. Bayesian majority rule consensus tree inferred from the plastid DNA trnL-F dataset. Numbers abovebranches are posterior probability (PP) and likelihood as well as parsimony bootstrap (BS) values, respectively. Values>50 % are shown.

FIGURE 1 in Evolutionary history of the tribe Astereae in the Flora Iranica area: Systematic implications

FIGURE 1. Bayesian majority rule consensus tree inferred from the combined nuclear DNA (ITS+ETS) data. Numbers above branches are posterior probability (PP) and likelihood as well as parsimony bootstrap (BS) values, respectively. Values>50 % are shown.

FIGURE 3 in Evolutionary history of the tribe Astereae in the Flora Iranica area: Systematic implications

FIGURE 3. Bayesian majority rule consensus tree inferred from the combined nrDNA+cpDNA dataset. Numbers abovebranches are posterior probability (PP) and likelihood as well as parsimony bootstrap (BS) values, respectively. Values>50 % are shown.

FIGURE 4 in Evolutionary history of the tribe Astereae in the Flora Iranica area: Systematic implications

FIGURE 4. Beast maximum clade credibility chronogram based on the Bayesian analysis of the combined nrDNA dataset. The 95% highest posterior density intervals (blue bars) are depicted. The numbers written above the nodes corresponding to the mean divergence time estimate shown in Table 3.

PLATE 2 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 2. Serrasalmus manueli (10) and S. gouldingi (11–15). (Photographs of S. gouldingi specimens 12 and 14 by Donald Taphorn.)

FIGURE 7 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 7. Phylogenetic trees of serrasalmids inferred from ribosomal (A) and control region (B) data sets, both including original material and GenBank sequences. Parsimony bootstrap percentages are shown above branch nodes, while proportions (>50%) of trees possessing a given clade in Bayesian posterior distributions are shown below. Taxa shared by both trees are in bold font. Specimen sequences from original material appear in shadow boxes, preceding numbers (1-33) correspond to numbered specimens and information presented in Table 1 and elsewhere. GenBank sequences are followed by gb. Taxa with VNTR in control region marked by an "R" and reconstruction of presence of VNTR shown in blue. GenBank (gb) species with asterisk (*) indicate taxa of which we question the identification.

FIGURE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 6. Primers used for amplifying and sequencing the control region and adjacent tRNAs. Internal primers 5'-3': 662F – ACCATGCCAAGGCGTTCTTT, 662R – AAAGAACGCCTTGGCATGGT, 724F – ACATTTGGTCACTTTCG- GAGA, 462R – CGGTTGGTGGTCTCTTACTACA, F-TTF2 – CGCCACCAGAAAAGAGAGAT, and F-12R2 - GCCCGTGGAACTTTCTAGG

PLATE 5 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 5. Serrasalmus irritans (24), Pygocentrus cariba (25), and Pygopristis denticulatus (27). (No photograph or voucher available for specimen 26.)

FIGURE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 1. Alternative hypotheses of serrasalmid relationships: (A) Machado-Allison (1983, 1985), based on morphology, divides family into two major clades; (B) Machado-Allison et al. (1989) revised piranha clade showing the position of Pristobrycon striolatus if absence of pre-anal spine is considered to be primitive character (arrow indicates occurrence of this trait); (C) Ortí et al. (1996), based on mitochondrial ribosomal RNA sequence data, defines three major clades. Upper tree includes 13 of the currently 15 recognized genera, lower tree includes 11 genera. Note: the genus Tometes was presented in original tree of Ortí et al. (1996) as "N. gen. A" (P. Petry, pers. comm. 2005). The authors also stated that specimens assigned by Machado-Allison (1982, 1983) to Utiaritichthys do not belong to that genus, apparently suggesting the specimens are Tometes.

PLATE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 6. Pristobrycon striolatus (28–31) and additional small juvenile specimens collected with genetic vouchers showing life colors.

FIGURE 3 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 3. Diet and intestinal length data mapped onto Machado-Allison's (1985) proposed phylogeny (modified from Nico 1991). Diet data based on 18 serrasalmid species from the Orinoco River basin (Venezuela); number in parentheses following generic name represents numbers of species in each genus included in study; Jv = juvenile trait; ad = adult trait; long intestine defined as mean intestine length>1.2 X standard length.

PLATE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 1. Serrasalmus manueli (1–9). (No photograph or voucher available for specimen 3.) (Photograph of 8-S. manueli by Frank Pezold.)

FIGURE 5 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 5. Adult and juvenile specimens of Serrasalmus gouldingi (A and B) and S. manueli (C and D) from southern Venezuela. Adult specimens (upper frame) are 195 and 240 mm SL; juvenile specimens (lower frame) are both 65 mm SL. Museum catalogue numbers for A-D: UF 148231, UF 120211, UF 121513, and UF 81180.

FIGURE 2 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 2. Van Every and Kritsky (1992) hypothesis of the evolutionary relationships of 10 piranha species from the central Amazon based on their helminth (Anacanthorus) parasite fauna.