Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
4,725
datasets available to search
ShareScore release 0.9.0
Dataset results
4,725 results for “Normalization”
Demouchy_Moa_Island_unpolarized_normalized_FTIRSpectra
<p>This excel file contain de unpolarized FTIR spectra display in Figure 8 of Demouchy et al. submitted to Tectonophysics. The spectra are normalized to the thinckness and baseline corrected. Contact me if you have question.</p>
Supplementary data frames, AlphaFold models, Normal Mode Analysis (NMA) Data, and NMA of Corresponding NMR Ensembles in the S2RCI, MD, and S2 Datasets for "Gradations in protein dynamics captured by experimental NMR are not well represented by AlphaFold2 models and other computational metrics"
<h1><strong>Changes applied to V2</strong></h1> <p>In addition to the supplementary dataframes and AlphaFold models from each dataset in V1, V2 includes the additional data outlined below.</p> <p>The <strong>S2RCI</strong> and <strong>MD</strong> datasets include comprehensive analyses of AlphaFold2 models (both before and after truncation). These datasets feature: </p> <ul> <li><strong>AlphaFold2 Models</strong>: Both original and truncated structures. </li> <li><strong>WEBnma Modes</strong>: `modes.txt` files generated from WEBnma analysis, available for both non-truncated and truncated AF2 models. </li> <li><strong>Root-Mean-Square-Fluctuations (RMSF)</strong>: Profiles calculated before and after truncation of AF2 models. </li> <li><strong>NMR Data: Normal Mode Analysis (NMA)</strong>: Performed on corresponding NMR ensembles (see below). </li> </ul> <p> </p> <p>The <strong>NMR Data</strong> of NMA in these datasets includes: </p> <ul> <li>NMR ensembles </li> <li>Individual NMR models extracted from each ensemble </li> <li>STRIDE secondary structure calculations per-individual NMR models</li> <li>RMSF profiles per-individual NMR models</li> </ul> <p>For detailed information, please refer to the `Readme.txt` file within each corresponding folder. </p> <p>The <strong>S2 dataset</strong> includes all the features listed above, except for the NMR analysis.</p>
Estimating global transpiration from TROPOMI SIF with angular normalization and separation for sunlit and shaded leaves
<p>All three types of SIF-driven T models integrate canopy conductance (gc) with the Penman-Monteith model, differing in how gc is derived: from a SIFobs driven semi-mechanistic equation, a SIFsunlit and SIFshaded driven semi-mechanistic equation, and a SIFsunlit and SIFshaded driven machine learning model. </p> <p>The difference between a simplified SIF-gc equation and a SIF-gc equation is the treatment of some parameters and is shown in <a href="https://doi.org/10.1016/j.rse.2024.114586" rel="noreferrer">https://doi.org/10.1016/j.rse.2024.114586</a>.</p> <p>In this dataset, the temporal resolution is 1 day, and the spatial resolution is 0.2 degree.</p> <p>BL: SIFobs driven semi-mechanistic model</p> <p>TL: SIFsunlit and SIFshaded driven semi-mechanistic model</p> <p>hybrid models: SIFsunlit and SIFshaded driven machine learning model.</p>
Enhanced Alzheimer's Brain Scan Dataset: Normal and Synthesized
<div> <div> <div> <h2>Enhanced Alzheimer's Brain Scan Dataset: Normal and Synthesized</h2> </div> </div> </div> <div> <div> <div> <div> <h2>Unveiling the Invisible: A Novel Approach to Alzheimer's Image Analysis</h2> <h3>Dataset Overview</h3> <p>This unique dataset comprises two distinct sets of brain scan images related to Alzheimer's disease:</p> <ol> <li><strong>Normal Dataset</strong>: 2000 carefully selected images for each stage of Alzheimer's progression.</li> <li><strong>Synthesized Dataset</strong>: Corresponding enhanced images using our innovative pseudo-RGB transformation technique.</li> </ol> <p>Total Images: 16,000 (8,000 normal + 8,000 synthesized)</p> <h3>Why This Dataset Matters</h3> <ol> <li><strong>Enhanced Feature Visibility</strong>: The synthesized images amplify subtle brain structures that may be indicative of Alzheimer's progression.</li> <li><strong>Multi-Perspective Analysis</strong>: By providing both normal and synthesized versions, this dataset enables researchers to compare and leverage both representations.</li> <li><strong>Balanced Categories</strong>: With equal representation across Alzheimer's stages, this dataset supports unbiased model training.</li> <li><strong>Novel Research Opportunities</strong>: The unique pseudo-RGB transformation opens doors for innovative approaches in medical image analysis.</li> </ol> <h3>Potential Applications</h3> <ul> <li>Training more accurate deep learning models for Alzheimer's detection</li> <li>Comparative studies between traditional and enhanced image analysis techniques</li> <li>Exploration of feature importance in Alzheimer's diagnosis</li> <li>Development of new visualization tools for medical professionals</li> </ul> </div> </div> </div> </div>
Continuum Normalized MARCS synthetic spectra (DR16)
<p>Continuum Normalized MARCS synthetic spectra (<a href="https://data.sdss.org/sas/dr16/apogee/spectro/speclib/synth/turbospec/marcs/solarisotopes/" target="_blank" rel="noopener">DR16 MARCS</a>) following the procedure described in Appendix A1 of the research article <strong>tonalli: an asexual genetic code to characterize APOGEE-2 stellar spectra. I. Validation with synthetic and solar spectra.</strong></p>
Intermittent Slip Along the Alto Tiberina Low-Angle Normal Fault in Central Italy
<p>Small magnitude events have regularly shaken the 50-km-long Alto Tiberina low-angle normal fault (ATF) in central Italy. Above it, few kilometers long syn- and antithetic higher-angle normal faults were active with many moderate seismic sequences and 10 times more events than ATF between 2010 and 2014. To better understand the fault system interaction, we apply a technique for finding events which match predefined templates to improve the ATF seismic catalog. The results indicate that productive sequences in the shallower high-angle faults often hamper the detection of microseismicity along with the ATF and that events are released at intermittent rates. Moreover, the seismic activity is mainly organized in clusters of small earthquakes lasting days or months with no identifiable mainshock. These clusters span a 30-km-long segment and coincide with transient deformation recorded at the end of 2013.</p>
The new normal? Redaction bias in biomedical science
<p>A concerning amount of biomedical research is not reproducible. Unreliable results impede empirical progress in medical science, ultimately putting patients at risk. Many proximal causes of this irreproducibility have been identified, a major one being inappropriate statistical methods and analytical choices by investigators. Within this, we formally quantify the impact inappropriate redaction beyond a threshold value in biomedical science. This is effectively truncation of a data-set by removing extreme data points, and we elucidate its potential to accidentally or deliberately engineer a spurious result in significance testing. We demonstrate that the removal of a surprisingly small number of data points can be used to dramatically alter a result. It is unknown how often redaction bias occurs in the broader literature, but given the risk of distortion to the literature involved, we suggest that it must be studiously avoided, and mitigated with approaches to counteract any potential malign effects to the research quality of medical science.</p>
FOXO transcription factors are required for normal somatotrope function and growth
<p><strong>Supplemental Fig 1. <em>Prop1 </em>and <em>Sst</em> expression is unchanged in dKO mice. </strong>Whole pituitary glands were collected from WT and dKO mice at 6 weeks of age. RNA was isolated and cDNA generated in order to evaluate mRNA abundance for <em>Prop1 </em>in females and males. Hypothalamus was collected to evaluate expression of <em>Sst</em>.<em> </em>Expression was normalized to <em>Tfrc</em>. The data represent 7-8 animals for each genotype and sex and were analyzed using Student’s t test.</p> <p><strong>Supplemental Fig 2. Gonadotrope, thyrotrope and corticotrope cells appear normally distributed in dKO mice. </strong>Immunohistochemistry for LHB, TSHB, and ACTH was performed on pituitary gland tissue from female and male mice to determine the distribution of gonadotropes, thyrotropes, and corticotropes, respectively. No obvious difference was observed between dKO mice and WT controls. Scale bars represent 100 mm. Representative images of three animals per genotype and sex are shown.</p> <p><strong>Supplemental Fig 3. Lactotrope cells appear normally distributed in dKO mice.</strong> Immunohistochemistry for PRL was performed on pituitary gland tissue from female and male mice to determine the distribution of lactotropes. No apparent difference in lactotrope distribution was observed between dKO mice and WT controls. Scale bars represent 100 mm. Representative images of three animals per genotype and sex are shown.</p> <p><strong>Supplemental Fig 4. <em>Foxo1 </em>and <em>Foxo3</em> expression levels in liver and hypothalamus of dKO mice. </strong>Liver and hypothalamus were collected from WT and dKO mice at 6 weeks of age. RNA was isolated and cDNA generated in order to evaluate mRNA abundance for <em>Foxo1 </em>and <em>Foxo3 </em>in females and males. Expression was normalized to <em>Tfrc</em>. The data represent 5-8 animals for each genotype and sex and were analyzed using Student’s t test (*p<0.05, **p<0.01, ***p<0.001).</p> <p> </p> <p><strong>Materials and Methods</strong></p> <p><em>Animals and genotyping</em></p> <p> To obtain <em>Foxo1<sup>Δpit</sup></em> mice <em>Foxo1<sup>+/-</sup></em> mice (15) were mated to <em>Foxg1<sup>+/cre</sup></em> mice (10) to produce <em>Foxo1<sup>+/-</sup>;Foxg1<sup>+/cre</sup></em> mice. These were then mated to <em>Foxo1<sup>fl/fl</sup></em> mice (13) to obtain <em>Foxo1<sup>fl/-</sup>;Foxg1<sup>+/cre</sup></em> (<em>Foxo1<sup>Δpit</sup></em>) mice. Experimental <em>Foxo1<sup>fl/fl</sup>;Foxo3<sup>fl/fl</sup>;Foxg1<sup>+/cre</sup></em> (dKO) animals were generated by crossing <em>Foxo1<sup>fl/fl</sup>;Foxo3<sup>fl/fl</sup></em> females with <em>Foxo1<sup>+/fl</sup>;Foxo3<sup>fl/fl</sup>;Foxg1<sup>+/cre</sup></em> males. <em>Foxg1<sup>+/cre</sup></em> mice were purchased from Jackson Laboratories, Bar Harbor, ME, USA (stock no. 004337) and were maintained on a 129SvJ (stock no. 000691) background (10,11). <em>Foxo1<sup>fl/fl</sup></em> mice (Jackson Laboratories, stock no. 024756) which have <em>loxP</em> sites flanking exon two of the <em>Foxo1</em> gene (15) were a generous gift from Drs. Accili and Pajvani, with permission from Dr. DePinho. <em>Foxo1<sup>+/-</sup></em> mice (15) were provided by Drs. Accili and Pajvani.<em> Foxo3<sup>fl/fl</sup></em> mice were purchased from Jackson Laboratories (stock no. 024668) (16). Genotyping was performed using specific primers for <em>Foxo1-null </em>(<em>LacZ</em> fwd and rev),<em> Foxo1-flox </em>(FK1ckA-C),<em> Foxg1-cre </em>(<em>cre </em>fwd and rev), and <em>Foxo3-flox </em>(ofk2ck1-3). A list of primers used can be found in Table S1.</p> <p> All mice were housed in a 12-hour light/dark cycle with feed (Formulab Diet 5008; Purina Mills, Gray Summit, MO, USA) and water <em>ad libitum</em>. Animals were weighed once per week starting at postnatal day seven. Mice were euthanized using CO<sub>2</sub> inhalation. Mouse length was measured post-euthanization by measuring from nose to rump. All procedures were conducted in accordance with the principles and procedures outlined in the National Institutes of Health Guidelines for the Care and Use of Experimental Animals and in accordance with Southern Illinois University Carbondale policies.</p> <p><em>Immunohistochemistry</em></p> <p> Pituitary gland tissue was collected post-euthanization and fixed in 10% formalin in PBS then dehydrated in graded ethanol solutions (50% then 80%). Tissue was then embedded in paraffin blocks and cut into 5 μm sections and mounted on positively charged slides. All immunohistochemistry (IHC) was begun by deparaffinization and rehydration of tissue sections using xylene (twice for 5 minutes each), 100% ethanol (twice for 3 minutes each), 95% ethanol (twice for 3 minutes each), then PBS. For immunofluorescent detection where antibody signal was amplified (Supplemental Table S2), slides were then incubated in 1.5% H<sub>2</sub>O<sub>2</sub> for 20 minutes. All tissue sections were blocked for 60 minutes using the Tyramide Signal Amplification (TSA) Kit Blocking Solution (TSB; Perkin Elmer, Waltham, MA, USA), which was also used as the diluent for all antibody solutions. Primary antibodies were incubated overnight at 4°C but all other steps were performed at room temperature (RT). After primary antibody incubation, tissue sections were washed three times for 3 minutes each in PBS-TWEEN 20 (PBS-T, 0.05%). Fluorophore-conjugated secondary antibody was then incubated on tissue sections for 60 minutes. Nuclei were stained using 4’,6’-diamidino-2-phenylindole (DAPI). Sections were then mounted using immunofluorescent mount (0.5 mM polyvinyl alcohol, 0.12 M Tris pH 8.0, 0.3% w/v glycerol, 2.5% w/v 1,4-diazabicyclo[2.2.2]octane) and glass coverslips.</p> <p> Imaging was performed using a Retiga 2000R digital camera attached to a Leica DM 5000B fluorescent microscope (Leica Biosystems, St. Louis, MO, USA). Individual captures of FITC and DAPI channels were merged using Adobe Photoshop CS3. Some images were brightened for illustrative purposes; however, the exact alterations were duplicated in both control and experimental images to maintain the ability to compare results. Three animals per genotype were analyzed for these studies.</p> <table> <tbody> <tr> <td> <p><strong>Name</strong></p> </td> <td> <p><strong>ID</strong></p> </td> <td> <p><strong>Antigen</strong></p> </td> <td> <p><strong>Citation</strong></p> </td> <td> <p><strong>Host</strong></p> </td> <td> <p><strong>Company</strong></p> </td> <td> <p><strong>Cat. No.</strong></p> </td> <td> <p><strong>Dilution</strong></p> </td> </tr> </tbody> </table> <table> <tbody> <tr> <td> <p>Rabbit anti-mouse PRL antibody</p> </td> <td> <p><a href="http://antibodyregistry.org/AB_2721133">AB_2721133</a></p> </td> <td> <p>mouse PRL</p> </td> <td> <p>(A.F. Parlow National Hormone and Peptide Program Cat# AFP107120402, RRID:AB_2721133)</p> </td> <td> <p>rabbit</p> </td> <td> <p>A.F. Parlow National Hormone and Peptide Program</p> </td> <td> <p>AFP10712402</p> </td> <td> <p>IF 1:10000</p> </td> </tr> </tbody> </table> <table> <tbody> <tr> <td> <p>Rabbit anti-Rat TSHβ antibody</p> </td> <td> <p><a href="http://antibodyregistry.org/AB_2665563">AB_2665563</a></p> </td> <td> <p>rat TSHB</p> </td> <td> <p>(A.F. Parlow National Hormone and Peptide Program Cat# rTSHb, RRID:AB_2665563)</p> </td> <td> <p>rabbit</p> </td> <td> <p>A.F. Parlow National Hormone and Peptide Program</p> </td> <td> <p>rTSHb also AFP-1274789</p> </td> <td> <p>IF 1:2000</p> </td> </tr> <tr> <td> <p>ACTH (adrenocorticotropic hormone) antibody</p> </td> <td> <p><a href="http://antibodyregistry.org/AB_2313902">AB_2313902</a></p> </td> <td> <p>ACTH</p> </td> <td> <p>(National Hormone & Peptide Program, Torrance, CA Cat# AFP-156102789, RRID:AB_2313902)</p> </td> <td> <p>rabbit</p> </td> <td> <p>A.F. Parlow National Hormone and Peptide Program</p> </td> <td> <p>AFP-156102789</p> </td> <td> <p>IF 1:500</p> </td> </tr> </tbody> </table> <p><em>RTqPCR</em></p> <p> Tissue collected for mRNA analysis was stored in RNA Later (AM7021, Invitrogen, Carlsbad, CA, USA) until use. Whole pituitary glands were lysed, and RNA was extracted and purified using the RNAqueous Micro Kit (AM1931) according to the kit protocol. The resultant mRNA was reversed transcribed to cDNA using the Promega M-MLV kit according to included instructions (M5313, Promega, Madison, WI, USA). Ten ng of cDNA were used for mRNA analysis. All samples were run in duplicate and a sample processed with no reverse transcriptase enzyme was included as a negative control. Results were calculated using the ΔΔCt method by first normalizing to RNA-polymerase subunit II b (<em>Polr2b</em>) as an internal control then calculated relative to transferrin receptor (<em>Tfrc</em>) to compare between groups. Both genes are expressed at consistent levels between genotypes. At least five mice per genotype were used in these studies.</p> <table> <tbody> <tr> <td> <p><strong>Name</strong></p> </td> <td> <p><strong>Sequence (5’ to 3’)</strong></p> </td> </tr> </tbody> </table> <table> <tbody> <tr> <td> <p>LacZ fwd</p> </td> <td> <p>TTCACTGGCCGTCGTTTTACAAGCTCGTGA</p> </td> </tr> <tr> <td> <p>LacZ rev</p> </td> <td> <p>ATGTGAGCGAGTAACAACCCGTCGGATTCT</p> </td> </tr> <tr> <td> <p>FK1ckA</p> </td> <td> <p>GCTTAGAGCAGAGATGTTCTCACATT</p> </td> </tr> <tr> <td> <p>FK1ckB</p> </td> <td> <p>CCAGAGTCTTTGTATCAGGCAAATAA</p> </td> </tr> <tr> <td> <p>FK1ckC</p> </td> <td> <p>CAAGTCCATTAATTCAGCACATTGA</p> </td> </tr> <tr> <td> <p><em>cre </em>fwd</p> </td> <td> <p>GCGGTCTGGCAGTAAAAACTATC</p> </td> </tr> <tr> <td> <p><em>cre </em>rev</p> </td> <td> <p>GTGAAACAGCATTGCTGTCACTT</p> </td> </tr> <tr> <td> <p>ofk2ck3</p> </td> <td> <p>CATGCAGTCCGAGAGATTTG</p> </td> </tr> <tr> <td> <p>ofk2ck2</p> </td> <td> <p>AGTGTCTGATACCGAAGAGC</p> </td> </tr> <tr> <td> <p>ofk2ck1</p> </td> <td> <p>AACAACCTCACACATGTGCC</p> </td> </tr> <tr> <td> <p><em>mPolr2b </em>RTqPCR<em> </em>fwd</p> </td> <td> <p>AGATGTATGACGCCGACGAG</p> </td> </tr> <tr> <td> <p><em>mPolr2b </em>RTqPCR<em> </em>rev</p> </td> <td> <p>GTAAGAACTGATCACGATCCAGCA</p> </td> </tr> <tr> <td> <p><em>mTfrc </em>RTqPCR<em> </em>fwd</p> </td> <td> <p>GCAAGATGTAAAGCATCCAGTTGATGG</p> </td> </tr> <tr> <td> <p><em>mTfrc </em>RTqPCR<em> </em>rev</p> </td> <td> <p>GCATATTCTGGAATCCCAGCAG</p> </td> </tr> </tbody> </table> <table> <tbody> <tr> <td> <p><em>mFoxo1 </em>RTqPCR<em> </em>fwd</p> </td> <td> <p>AGGATAAGGGCGACAGCAAC</p> </td> </tr> <tr> <td> <p><em>mFoxo1 </em>RTqPCR<em> </em>rev</p> </td> <td> <p>CCGCTCTTGCCTCCCTC</p> </td> </tr> <tr> <td> <p><em>mFoxo3 </em>RTqPCR<em> </em>fwd</p> </td> <td> <p>GGGCGACAGCAACAGCT</p> </td> </tr> <tr> <td> <p><em>mFoxo3 </em>RTqPCR<em> </em>rev</p> </td> <td> <p>CCCGCTCTTTCCCCCATC</p> </td> </tr> </tbody> </table> <table> <tbody> <tr> <td> <p><em>mProp1 </em>RTqPCR fwd</p> </td> <td> <p>GCCTCTGGGACTCTGATCTCC</p> </td> </tr> <tr> <td> <p><em>mProp1</em> RTqPCR rev</p> </td> <td> <p>CAGGATACTGGTTCCTCCCAA</p> </td> </tr> <tr> <td> <p><em>mSst </em>RTqPCR fwd</p> </td> <td> <p>TCTGCATCGTCCTGGCTTTG</p> </td> </tr> <tr> <td> <p><em>mSst </em>RTqPCR rev</p> </td> <td> <p>GACAGCAGCTCTGCCAAGAA</p> </td> </tr> </tbody> </table> <p> </p> <p><em>Statistical analysis</em></p> <p> All data were analyzed using Student’s t test unless otherwise noted where (*) indicates p < 0.05, (**) indicates p < 0.01, (***) indicates p < 0.001, and (****) indicates p < 0.0001. Error bars indicate standard error of the mean (SEM).</p>
Normal Retinotopy in Primary Visual Cortex in a Congenital Complete Unilateral Lesion of Lateral Geniculate Nucleus in Human: A Case Study
<p>The data set contains .nii files for each condition of retinotopic mapping in fMRI. (Meridians, Wedges and concentric rings). It also contains DTI data files with .bvec and .bval files. Psychophysics data is in two excel files for motion and orientation discrimination. </p>
A novel strategy for fully automated segmentation of supratentorial meningiomas: Use of pre-trained models and inclusion of normal brain images
<p>This repository is accompanying MRI datasets under the journal, titled: <strong>A novel strategy for fully automated segmentation of supratentorial meningiomas: Use of pre-trained models and inclusion of normal brain images</strong>. </p> <p>Nii_data.tar.gz (zipped) file includes MRI images of all patients described in the paper that are formatted as .nii.</p>
Accompanying dataset for: A Multi-scale, Multiomic Atlas of Human Normal and Follicular Lymphoma Lymph Nodes
<p>This dataset accompanies the manuscript titled “A Multi-scale, Multiomic Atlas of Human Normal and Follicular Lymphoma Lymph Nodes”, A. Radtke et al., bioRxiv, 2022. [<a href="https://doi.org/10.1101/2022.06.03.494716">doi: 10.1101/2022.06.03.494716</a>]</p> <p>The dataset contains the processed scRNA-seq information from human lymph nodes, both normal and from Follicular Lymphoma (FL) patients analyzed in this work as a Seurat object. The scRNA-seq information was saved in the rds format for viewing and analysis using the R programming language (to load it in R: <em>scrna_seq_data <- readRDS("scRNA_seq_data_object.rds")</em>).</p> <p>Additionally, the dataset contains comma-separated-value tables describing human lymph nodes, both normal and from Follicular Lymphoma (FL) patients. The files are formatted using the anatomical structures (AS), cell types (CT), and biomarkers (B), ASCT+B format defined by the Human BioMolecular Atlas Program (HuBMAP) for use with the <a href="http://hubmapconsortium.github.io/ccf-asct-reporter/">Reporter visualization tool</a>. Details on the structure of ASCT+B tables and the Reporter tool can be found in the <a href="https://doi.org/10.5281/zenodo.5944386">standard operating procedure</a> authored by the ASCT+B working group. </p> <p><strong>ASCT+B Table Details</strong></p> <p>In support of a human reference atlas (Regev et al., 2017; Snyder et al., 2019), the Human BioMolecular Atlas Program (HuBMAP) is creating machine readable tables that catalog the anatomical structures (AS), cell types (CT), and biomarkers (B) found in human organs (Börner et al., 2021). ASCT+B tables facilitate data integration across multimodal assays and support comparisons between normal and diseased tissues. In addition, they are readily visualized with the <a href="http://hubmapconsortium.github.io/ccf-asct-reporter/">ASCT+B Reporter</a>, a web based tool.</p> <p><br> For these reasons, we created 10 ASCT+B tables from the datasets included in our study. To construct these tables, we used the <a href="https://doi.org/10.48539/HBM573.SHCQ.259">Lymph Node v1.1 ASCT+B table</a> as a starting point. The presence or absence of anatomical structures was determined by visual inspection of images and quantitative image analysis of cellular communities. Certain anatomical structures were absent from the excisional biopsies of FL patients e.g., capsule, medulla, hilum, etc. In contrast, the lack of primary follicles, mantle zones, polarized germinal centers (GC), and negligible interfollicular cortex and paracortex in FL LNs reflects changes arising from malignancy. Cell types were defined based on gene biomarkers from bulk and single cell RNA sequencing (RNA-seq) and protein biomarkers from the highly multiplexed imaging method, IBEX (Radtke et al., 2022; Radtke et al., 2020). Whenever possible, cell types captured across assays were defined by both gene and protein biomarkers. However, several cell types were only profiled by bulk RNA-seq, scRNA-seq, or IBEX imaging. In these instances, only assay-specific biomarkers are included in the ASCT+B tables. Whenever possible, we used agreed upon ontology terms to define cell types; however, our study identified several unique cell types not included in ontology databases such as DC-SIGN+ follicular dendritic cells (FDCs). Furthermore, the Reporter does not allow visualization of similar cell types (DC-SIGN- FDCs versus DC-SIGN+ FDCs) in the same anatomical structure if a shared Cell Ontology (CL) identifier is used (FDC: CL:0000442). In these instances, we removed the CL term to allow the Reporter to display the various subpopulations discovered in this study. Cell types were placed in their respective anatomical structures using domain knowledge, visual inspection of images, and quantitative image analysis.</p> <p><strong>Reporter Usage Instructions</strong></p> <ul> <li>Visualizing an individual ASCT+B table: <ol> <li>Go to <a href="https://hubmapconsortium.github.io/ccf-asct-reporter/">Reporter</a></li> <li>Launch Playground</li> <li>Click on Upload tab</li> <li>Attach CSV final of ASCT+B table</li> <li>Use the toolbars on the left to adjust display. Typical parameters include: Tree Height (1400),Tree width (1000), Bimodal Distance X (500), and Bimodal Distance Y (50). </li> <li>Toggle between gene and protein biomarkers by clicking drop down menu under Biomarkers tab on left-side of screen.</li> </ol> </li> <li>Comparing non-FL and FL tables to the Lymph Node v1.1 ASCT+B table: <ol> <li>Go to <a href="https://hubmapconsortium.github.io/ccf-asct-reporter/">Reporter</a></li> <li>Select “go to visualization” to compare new tables to a master table for lymph node</li> <li>Click check box next to lymph node and select version of published master table v1.1</li> <li>Click submit</li> <li>Click compare button at top right tool bar</li> <li>Attach CSV file of non-FL and FL ASCT+B tables </li> <li>Pick colors </li> <li>Go to bottom of panel and click add</li> <li>Click compare</li> <li>Adjust settings for tree height, tree width, bimodal distance x, bimodal distance y, ontology ID on or off, biomarker type (gene or protein), etc.</li> </ol> </li> </ul> <p><strong>References</strong></p> <ul> <li>Börner, K., Teichmann, S.A., Quardokus, E.M., Gee, J.C., Browne, K., Osumi-Sutherland, D., Herr, B.W., Bueckle, A., Paul, H., Haniffa, M., et al. (2021). Anatomical structures, cell types and biomarkers of the Human Reference Atlas. Nature Cell Biology 23, 1117-1128.</li> <li>Radtke, A.J., Chu, C.J., Yaniv, Z., Yao, L., Marr, J., Beuschel, R.T., Ichise, H., Gola, A., Kabat, J., Lowekamp, B., et al. (2022). IBEX: an iterative immunolabeling and chemical bleaching method for high-content imaging of diverse tissues. Nature Protocols.</li> <li>Radtke, A.J., Kandov, E., Lowekamp, B., Speranza, E., Chu, C.J., Gola, A., Thakur, N., Shih, R., Yao, L., Yaniv, Z.R., et al. (2020). IBEX: A versatile multiplex optical imaging approach for deep phenotyping and spatial analysis of cells in complex tissues. Proc Natl Acad Sci U S A 117, 33455-33465.</li> <li>Regev, A., Teichmann, S.A., Lander, E.S., Amit, I., Benoist, C., Birney, E., Bodenmiller, B., Campbell, P., Carninci, P., Clatworthy, M., et al. (2017). The Human Cell Atlas. Elife 6.</li> <li>Snyder, M.P., Lin, S., Posgai, A., Atkinson, M., Regev, A., Rood, J., Rozenblatt-Rosen, O., Gaffney, L., Hupalowska, A., Satija, R., et al. (2019). The human body at cellular resolution: the NIH Human Biomolecular Atlas Program. Nature 574, 187-192.</li> </ul> <p> </p>
Data for bulk ATAC-seq normalization paper
<p>This zipped file contains all public datasets used in our benchmark of bulk ATAC-seq normalization methods.</p>
Normales climatiques 1981-2010 France
<p>Normales climatiques des 1848 stations Météo France sur la période 1981-2010 à partir des données sous licence Etalab de Météo France. Contient :</p> <table> <tbody> <tr> <td>Onglet</td> <td>Description</td> <td>Unité</td> </tr> <tr> <td>Coordonnées</td> <td>Coordonnées converties en Lambert93</td> <td>-</td> </tr> <tr> <td>Période</td> <td>Période sur laquelle est calculée la normale</td> <td>-</td> </tr> <tr> <td>RR</td> <td>Précipitations moyennes mensuelles</td> <td>mm</td> </tr> <tr> <td>Txm</td> <td>Température maximale moyenne mensuelle</td> <td>°C</td> </tr> <tr> <td>Tm</td> <td>Température moyenne mensuelle</td> <td>°C</td> </tr> <tr> <td>Tnm</td> <td>Température minimale moyenne mensuelle</td> <td>°C</td> </tr> <tr> <td>JFChaleur</td> <td>Nombre de jours avec T > 30°C (jours de forte chaleur)</td> <td>jours</td> </tr> <tr> <td>JChaleur</td> <td>Nombre de jours avec T > 25°C (jours de chaleur)</td> <td>jours</td> </tr> <tr> <td>JNoDegel</td> <td>Nombre de jours sans dégel</td> <td>jours</td> </tr> <tr> <td>JGel</td> <td>Nombre de jours de gelée</td> <td>jours</td> </tr> <tr> <td>JFGel</td> <td>Nombre de jours avec T<-5°C (forte gelée)</td> <td>jours</td> </tr> <tr> <td>JTFGel</td> <td>Nombre de jours avec T<-10°C (très forte gelée)</td> <td>jours</td> </tr> <tr> <td>JPluie</td> <td>Nombre de jours de pluie >1mm</td> <td>jours</td> </tr> <tr> <td>JPluie5</td> <td>Nombre de jours de pluie >5mm</td> <td>jours</td> </tr> <tr> <td>JPluie10</td> <td>Nombre de jours de pluie >10mm</td> <td>jours</td> </tr> </tbody> </table>
Frictional Properties of Opalinus Clay: Influence of Humidity, Normal Stress and Grain-size on Frictional Stability
<p>We designed frictional experiments to characterize the effect exerted by humidity, grain size and normal stress on frictional behaviour of the Opalinus clay fault gouge. We explored a wide range of normal stresses, ranging from 5 to 70 MPa performing velocity up-steps from 1 to 300 μm/s and slide-hold-slide from 1 to 3000s. Our experiments confirms that the OPA clay is weak, with friction coefficients at steady-state of ~0.35 and ~0.41, for 100% RH and 25% RH experiments, respectively. The OPA clay is velocity strengthening over the entire range of applied normal stress. We observe a direct relationship between frictional parameter <em>(a-b)</em> and slip velocity up to 35 MPa where, from there on, <em>(a-b)</em> parameter seems to be velocity independent. As evidenced by the microstructural analysis, we suggest that this behaviour is due to the progressive transition with normal stress, from strain localization and grain size reduction to distributed deformation on well-developed phyllosilicate networks. The amount of relative humidity does not affect deformation mechanisms (i.e. localized or distributed), whereas decreases fault strength and increases fault stability. We hypothesize that this is due to a possible interplay of OPA clay swelling and lubrication, caused by the weakening of chemical bonds between phyllosilicate foliae. Notably, the initial grain size (< 63 µm or 63 < g.s. < 125 µm) does not affect either the frictional strength or stability, with similar values of dilation upon velocity up-step. Collectively, our mechanical and microstructural observations have allowed us to build a conceptual model that summarizes the main mechanical features of the OPA clay fault gouge. In the context of deep geological repositories (DGR), our results confirm that slow aseismic slip is the most likely slip behaviour for a fault gouge hosted in the OPA clay, with similar mineralogical composition and clay fabric as our samples. Beyond the context of deep geological repositories, this study has also implications for carbon capture and geological storage in the deep subsurface. Indeed, OPA has the characteristics of a low permeability caprock, but faulted, and the integrity of a sealing caprock overlying a storage reservoir can evolve after fault reactivation, potentially generating undesired seismicity and new hydraulic pathways.</p> <p>The data are uploaded are structured as follow:</p> <p>1) A .txt file of the datafile that is recorded from the machine (raw data)</p> <p>2) A file in .txt format containing the elaborated data (data_rp) </p> <p>The data are analyzed using rawPy that can be found at <a href="https://github.com/marcoscuderi/rawPy">https://github.com/marcoscuderi/rawPy</a></p> <p>For any additional information please do not hesitate to contact the corresponding author Nico Bigaroni at nico.bigaroni@uniroma1.it</p> <p> </p>
Genome-wide expression profile of AAV2-infected normal human fibroblasts
<p>Datasets containing the genome-wide expression profile of AAV2-infected normal human fibroblasts.</p> <p>Raw data: results--A1--over--M1-3.txt</p> <p>p<0.01, reads>40: A1_M1_p0.01_r40_fc not restricted.txt</p>
Text-fig. 2. Aptian to Albian Cerebropollenites taxa, all scale bars in LM and SEM overview images 10 µm, scale bars in SEM detailed images 2 µm. a–c: Cerebropollenites thiergartii from St. Pölten (Austria), a – LM image, equatorial view, b – SEM equatorial overview with visible, less sculptured leptoma, c – detail of echinate verrucae; d–f: Cerebropollenites thiergartii from Khovil basin (Mongolia), d – LM image polar view with well visible thin-walled leptoma, e – SEM of proximal polar view with faintly sculptures leptoma, f – SEM detailed view of transition from leptoma to normal sexine sculpturing; g–i: Cerebropollenites macroverrucosus from Khovil basin (Mongolia), g – LM image of oblique equatorial view, h – SEM of oblique equatorial view with concave leptoma, i – SEM detail of the rugulate to verrucate sexine and smaller sculpturing in leptoma area. in The Occurrence Of Pollen Of Sciadopityaceae Luerss. Through Time
Text-fig. 2. Aptian to Albian Cerebropollenites taxa, all scale bars in LM and SEM overview images 10 µm, scale bars in SEM detailed images 2 µm. a–c: Cerebropollenites thiergartii from St. Pölten (Austria), a – LM image, equatorial view, b – SEM equatorial overview with visible, less sculptured leptoma, c – detail of echinate verrucae; d–f: Cerebropollenites thiergartii from Khovil basin (Mongolia), d – LM image polar view with well visible thin-walled leptoma, e – SEM of proximal polar view with faintly sculptures leptoma, f – SEM detailed view of transition from leptoma to normal sexine sculpturing; g–i: Cerebropollenites macroverrucosus from Khovil basin (Mongolia), g – LM image of oblique equatorial view, h – SEM of oblique equatorial view with concave leptoma, i – SEM detail of the rugulate to verrucate sexine and smaller sculpturing in leptoma area.
Text-fig. 4. a: Conglomeratic to massive sandstone facies 1, facies A are composed of Andesit (AF), Clay (CF) and Sandstone (SF) fragments lain on medium-sandstone. b: Conglomeratic to massive sandstone facies, outcropping of massive sandstone facies comprises of fine to medium grain size of grey to yellowish sandstone. c: Heterolithic sandstone-mudstone facies, intercalation of fine sand with silt and shale as type form of heterolithic sandstone mudstone as indicated by a high sand/shale ratio. d: Example outcrops of heterolithic sandstone-mudstone 2 indicated by low sand/shale ratio. e: Heterolithic fine sand and mudstone and mudstone facies, intercalation of thin sandstone and shale. f: Representative of slump deposits outcrops belong to conglomeratic to massive sandstone facies, which is indicated by the intercalation of sandstone and shale and some disturbed beds or layers as seen in slump deposits. The facies type is normally deposited within the basin floor, channel margin or as a product of the overbank deposits. In this figure the slump deposit is shown as internal bedding, some occurred on the bedding-plane. Trend slope measurement of the fold-axis revealed values N 135°E and N 108°E. in Lithofacies And Ichnofacies Of Turbidite Deposits, West Java, Indonesia
Text-fig. 4. a: Conglomeratic to massive sandstone facies 1, facies A are composed of Andesit (AF), Clay (CF) and Sandstone (SF) fragments lain on medium-sandstone. b: Conglomeratic to massive sandstone facies, outcropping of massive sandstone facies comprises of fine to medium grain size of grey to yellowish sandstone. c: Heterolithic sandstone-mudstone facies, intercalation of fine sand with silt and shale as type form of heterolithic sandstone mudstone as indicated by a high sand/shale ratio. d: Example outcrops of heterolithic sandstone-mudstone 2 indicated by low sand/shale ratio. e: Heterolithic fine sand and mudstone and mudstone facies, intercalation of thin sandstone and shale. f: Representative of slump deposits outcrops belong to conglomeratic to massive sandstone facies, which is indicated by the intercalation of sandstone and shale and some disturbed beds or layers as seen in slump deposits. The facies type is normally deposited within the basin floor, channel margin or as a product of the overbank deposits. In this figure the slump deposit is shown as internal bedding, some occurred on the bedding-plane. Trend slope measurement of the fold-axis revealed values N 135°E and N 108°E.
Figure 3: The dependencies ² 00 (log !¿¾). The values are normalized at ² 00 max-TOWARD THE PHYSICAL BASIS OF COMPLEX SYSTEMS: DIELECTRIC ANALYSIS OF POROUS SILICON NANOCHANNELS IN THE ELECTRICAL DOUBLE LAYER LENGTH RANGE
<p>Fig.3. The conductivity relaxation occurs at<br> lowing frequencies. The form of the ²<br> 00<br> (!) = f(²<br> 0<br> (!)) diagrams changes from<br> a vertical line (a), to any deformate semicircles (b, c, d) having the angle to<br> real axe below ¼<br> 2 , Fig.4. This behaviour denotes that the EDL is not an ideally<br> capacitor, but also is not a disipative region, depending both on the EDL<br> thickness and the frequency range of the applied ¯eld [7]. The composition<br> (by thickness) of the EDL determines essentially the dielectric response of the<br> interface system. Compared with experimental results, the dielectric pro¯le<br> of this higher length scales model, can provides a more complet description of<br> the solvent properties for a given electrode.</p>
Figure 2: The dependencies ² 0 (log !¿¾). The values are normalized at ² 0 max-TOWARD THE PHYSICAL BASIS OF COMPLEX SYSTEMS: DIELECTRIC ANALYSIS OF POROUS SILICON NANOCHANNELS IN THE ELECTRICAL DOUBLE LAYER LENGTH RANGE
<p>The results of the model are shown that the frequency-dependences ²<br> 0<br> (log(!¿¾))<br> in Fig.2, ²<br> 00(log(!¿¾)) in Fig.3 and ²<br> 00<br> (²<br> 0<br> )T in Fig.4, where ²<br> 0<br> , ²<br> 00<br> are the real and<br> imaginary part, respectively, from (7), having the ¸D<br> ¸ ratio as parameter.</p>
parallel-fibered bone; A5, osteocyte lacunae with well-preserved canaliculi; B3, osteocyte lacunae lacking canaliculi; B4, B5, growth pattern with preserved residuals of the thick annuli and zones (zo I–III) and thin annuli and zones (zo IV–VII); A6, growth pattern with preserved thin annuli and thick zones (zo I–IV), the dotted line marks the border between the perimedullary region and the cortex. Arrows in A5 and B3 indicate osteocyte lacunae; in B4, B5, and A6 indicate the annuli. Growth pattern in B4 figured on the lateral section side, in B5 and A5 on the ventral side; note the cortex thickness variation between B4 and B5. A1, A3, A4, A6, B1, B4, B5 in polarized light and A2, A5, B2, B3 in normal transmitted light. Abbreviations: an, annulus; ec, erosion cavity; pmr, perimedullary region; pos, primary osteon; sos, secondary osteon; zo, zone. in Palaeohistology helps reveal taxonomic variability in exceptionally large temnospondyl humeri from the Upper Triassic of Krasiejów, SW Poland
parallel-fibered bone; A5, osteocyte lacunae with well-preserved canaliculi; B3, osteocyte lacunae lacking canaliculi; B4, B5, growth pattern with preserved residuals of the thick annuli and zones (zo I–III) and thin annuli and zones (zo IV–VII); A6, growth pattern with preserved thin annuli and thick zones (zo I–IV), the dotted line marks the border between the perimedullary region and the cortex. Arrows in A5 and B3 indicate osteocyte lacunae; in B4, B5, and A6 indicate the annuli. Growth pattern in B4 figured on the lateral section side, in B5 and A5 on the ventral side; note the cortex thickness variation between B4 and B5. A1, A3, A4, A6, B1, B4, B5 in polarized light and A2, A5, B2, B3 in normal transmitted light. Abbreviations: an, annulus; ec, erosion cavity; pmr, perimedullary region; pos, primary osteon; sos, secondary osteon; zo, zone.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.