Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
1,164
datasets available to search
ShareScore release 0.9.0
Dataset results
1,164 results for “cave-dwelling”
Figure 1 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China
Figure 1. Bisetocreagris guangshanensis Gao & Zhang, sp. nov., a. male holotype, dorsal view; b. female paratype, dorsal view.
Figure 5 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China
Figure 5. Bisetocreagris gracilenta Gao & Zhang, sp. nov., female holotype: a. carapace (dorsal view); b. chelicerae (dorsal view); c. rallum; d. pedipalp (lateral view); e. leg I (lateral view); f. leg IV (lateral view); g. pedipalpal coxae (ventral view); h. left chela (retrolateral view). Scale bars: 0.1 mm (c); 0.5 mm (b); 1.00 mm (a, d–f, h).
Figures 9–16 - Neobisium curcici n in On the biodiversity of pseudoscorpions in Croatia: Neobisium curcici (Pseudoscorpiones: Neobisiidae), a new cave-dwelling species from Dalmatia (Croatia)
Figures 9–16 - Neobisium curcici n. sp., paratype tritonymph from the Jama pod Gažnovcem Pit, Stilja, near Vrgorac, Dalmatia, Croatia: 9 – carapace; 10 – epistome; 11 – chelicera; 12 – sternites II-IV; 13 – flagellum; 14 – pedipalp; 15 – pedipalpal chela; 16 – leg IV. Scale = 0.50 mm (Figs. 9, 14–16) and 0.25 mm (Figs. 10–13).
Figure 2 in Duvalius bozidari, a new cave-dwelling species of trechine ground beetles (Coleoptera: Carabidae: Trechinae) from western Serbia
Figure 2. The distribution of Duvalius (Neoduvalius) bozidari sp. n. (black circles) and D. (N.) guidononveilleri Janák & Moravec, 2008 (black star) in Serbia.
Figure 1 in Duvalius bozidari, a new cave-dwelling species of trechine ground beetles (Coleoptera: Carabidae: Trechinae) from western Serbia
Figure 1. Duvalius (Neoduvalius) bozidari sp. n. from the Jovanjska Pećina Cave, village of Jovanje, near Valjevo, western Serbia: a - holotype male, habitus (dorsal view); b - holotype male, aedeagus (lateral view); c - holotype male, aedeagus (dorsal view); d - holotype male, abdominal sternite IX (urite); e - paratype female, genitalia. Scales = 2.00 mm (a) and 0.20 mm (b–e).
Figures 1–3 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)
Figures 1–3. Bollmania beroni sp. n., male paratype. (1) Habitus, total length 35 mm. (2, 3) Close-ups of anterior end in lateral and ventral views, showing swollen gonopodal region and long protruding gonopods in situ.
Figures 13–18 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)
Figures 13–18. (13) Bollmania sp. 2 from Afghanistan: leg-pair 2, posterior view. (14) B. nodifrons, female: leg-pair 2, posterior view. (15) B. oblonga, female: leg-pair 2, posterior view. (16)Callipus foetidissimus, female: leg-pair 2, posterior view. (17) Apfelbeckia lendenfeldii, female: leg-pair 2, posterior view. (18) Callipodella fasciata, female: legpair 3, posterior view.
Figures 4–7 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)
Figures 4–7. Bollmania beroni sp. n., male. (4) Head, anterior pleurotergites and gonopod, lateral view. (5) Head, frontal view. (6) Telson, postero-lateral view. (7) Leg-pair 7, posterior view.
Figures 8–12 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)
Figures 8–12. (8–11) Bollmania beroni sp. n. (8) Gonopods, position in situ, caudal view. (9) Gonopod, mesal view. (10) gonopod, lateral view. (11) female: leg-pair 2, posterior view. (12) Bollmania sp. 1 from Afghanistan: leg-pair 2, posterior view.
Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.
Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.
Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Figure 80. Cicurina majiangensis Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China
Figure 80. Cicurina majiangensis Li, sp. nov., holotype, male. A. Palp bulb, ventral view. B. Right pedipalpus, ventral view. C. Right pedipalpus, retrolateral view. D. Right pedipalpus, prolateral view. Scale bars = 0.1 mm.
Figure 84. Cicurina wusanani Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China
Figure 84. Cicurina wusanani Li, sp. nov., holotype, male. A. Left pedipalpus, ventral view. B. Palp bulb, ventral view. Scale bars = 0.1 mm.
Figure 77. Cicurina kailiensis Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China
Figure 77. Cicurina kailiensis Li, sp. nov. A–D. Paratype, female. E. Holotype, male, habitus, dorsal view. A. Epigynum, ventral view. B. Vulva, dorsal view. C. Habitus, dorsal view. D. Habitus, ventral view. Scale bars: A–B = 0.05 mm; C–E = 0.5 mm.
Figure 91 in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China
Figure 91. Lathys chishuiensis Zhang, Yang & Zhang, 2009, paratype. A–D. Female. E. Male, habitus, dorsal view. A. Epigynum, ventral view. B. Vulva, dorsal view. C. Habitus, dorsal view. D. Habitus, ventral view. Scale bars: A–B = 0.1 mm; C–E = 0.5 mm.
Figure 83. Cicurina wusanani Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China
Figure 83. Cicurina wusanani Li, sp. nov., holotype, male. A. Left pedipalpus, prolateral view. B. Left pedipalpus, retrolateral view. Scale bar = 0.1 mm.
Figure 74. Cicurina kailiensis Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China
Figure 74. Cicurina kailiensis Li, sp. nov., holotype, male. A. Left pedipalpus, ventral view. B. Palp bulb, ventral view. Scale bars = 0.1 mm.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.