Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

1,164

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

1,164 results for “cave-dwelling”

Learn how ShareScore rates datasets ↗
zenodo40/100

Figure 1 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China

Figure 1. Bisetocreagris guangshanensis Gao & Zhang, sp. nov., a. male holotype, dorsal view; b. female paratype, dorsal view.

opencc-by-4.0Dec 2016View details →
zenodo40/100

Figure 5 in Description of two new cave-dwelling Bisetocreagris species (Pseudoscorpiones, Neobisiidae) from China

Figure 5. Bisetocreagris gracilenta Gao & Zhang, sp. nov., female holotype: a. carapace (dorsal view); b. chelicerae (dorsal view); c. rallum; d. pedipalp (lateral view); e. leg I (lateral view); f. leg IV (lateral view); g. pedipalpal coxae (ventral view); h. left chela (retrolateral view). Scale bars: 0.1 mm (c); 0.5 mm (b); 1.00 mm (a, d–f, h).

opencc-by-4.0Dec 2016View details →
zenodo40/100

Figures 9–16 - Neobisium curcici n in On the biodiversity of pseudoscorpions in Croatia: Neobisium curcici (Pseudoscorpiones: Neobisiidae), a new cave-dwelling species from Dalmatia (Croatia)

Figures 9–16 - Neobisium curcici n. sp., paratype tritonymph from the Jama pod Gažnovcem Pit, Stilja, near Vrgorac, Dalmatia, Croatia: 9 – carapace; 10 – epistome; 11 – chelicera; 12 – sternites II-IV; 13 – flagellum; 14 – pedipalp; 15 – pedipalpal chela; 16 – leg IV. Scale = 0.50 mm (Figs. 9, 14–16) and 0.25 mm (Figs. 10–13).

opencc-by-4.0Jul 2016View details →
zenodo40/100

Figure 2 in Duvalius bozidari, a new cave-dwelling species of trechine ground beetles (Coleoptera: Carabidae: Trechinae) from western Serbia

Figure 2. The distribution of Duvalius (Neoduvalius) bozidari sp. n. (black circles) and D. (N.) guidononveilleri Janák & Moravec, 2008 (black star) in Serbia.

opencc-by-4.0Dec 2016View details →
zenodo40/100

Figure 1 in Duvalius bozidari, a new cave-dwelling species of trechine ground beetles (Coleoptera: Carabidae: Trechinae) from western Serbia

Figure 1. Duvalius (Neoduvalius) bozidari sp. n. from the Jovanjska Pećina Cave, village of Jovanje, near Valjevo, western Serbia: a - holotype male, habitus (dorsal view); b - holotype male, aedeagus (lateral view); c - holotype male, aedeagus (dorsal view); d - holotype male, abdominal sternite IX (urite); e - paratype female, genitalia. Scales = 2.00 mm (a) and 0.20 mm (b–e).

opencc-by-4.0Dec 2016View details →
zenodo40/100

Figures 1–3 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)

Figures 1–3. Bollmania beroni sp. n., male paratype. (1) Habitus, total length 35 mm. (2, 3) Close-ups of anterior end in lateral and ventral views, showing swollen gonopodal region and long protruding gonopods in situ.

opencc-by-4.0Apr 2005View details →
zenodo40/100

Figures 13–18 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)

Figures 13–18. (13) Bollmania sp. 2 from Afghanistan: leg-pair 2, posterior view. (14) B. nodifrons, female: leg-pair 2, posterior view. (15) B. oblonga, female: leg-pair 2, posterior view. (16)Callipus foetidissimus, female: leg-pair 2, posterior view. (17) Apfelbeckia lendenfeldii, female: leg-pair 2, posterior view. (18) Callipodella fasciata, female: legpair 3, posterior view.

opencc-by-4.0Apr 2005View details →
zenodo40/100

Figures 4–7 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)

Figures 4–7. Bollmania beroni sp. n., male. (4) Head, anterior pleurotergites and gonopod, lateral view. (5) Head, frontal view. (6) Telson, postero-lateral view. (7) Leg-pair 7, posterior view.

opencc-by-4.0Apr 2005View details →
zenodo40/100

Figures 8–12 in A new cave-dwelling millipede of the genus Bollmania Silvestri, 1896 from Yunnan, China, with remarks on the reduction of the second female leg-pair (Diplopoda: Callipodida: Caspiopetalidae)

Figures 8–12. (8–11) Bollmania beroni sp. n. (8) Gonopods, position in situ, caudal view. (9) Gonopod, mesal view. (10) gonopod, lateral view. (11) female: leg-pair 2, posterior view. (12) Bollmania sp. 1 from Afghanistan: leg-pair 2, posterior view.

opencc-by-4.0Apr 2005View details →
zenodo40/100

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Figure 80. Cicurina majiangensis Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China

Figure 80. Cicurina majiangensis Li, sp. nov., holotype, male. A. Palp bulb, ventral view. B. Right pedipalpus, ventral view. C. Right pedipalpus, retrolateral view. D. Right pedipalpus, prolateral view. Scale bars = 0.1 mm.

opencc-by-4.0Dec 2017View details →
zenodo40/100

Figure 84. Cicurina wusanani Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China

Figure 84. Cicurina wusanani Li, sp. nov., holotype, male. A. Left pedipalpus, ventral view. B. Palp bulb, ventral view. Scale bars = 0.1 mm.

opencc-by-4.0Dec 2017View details →
zenodo40/100

Figure 77. Cicurina kailiensis Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China

Figure 77. Cicurina kailiensis Li, sp. nov. A–D. Paratype, female. E. Holotype, male, habitus, dorsal view. A. Epigynum, ventral view. B. Vulva, dorsal view. C. Habitus, dorsal view. D. Habitus, ventral view. Scale bars: A–B = 0.05 mm; C–E = 0.5 mm.

opencc-by-4.0Dec 2017View details →
zenodo40/100

Figure 91 in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China

Figure 91. Lathys chishuiensis Zhang, Yang & Zhang, 2009, paratype. A–D. Female. E. Male, habitus, dorsal view. A. Epigynum, ventral view. B. Vulva, dorsal view. C. Habitus, dorsal view. D. Habitus, ventral view. Scale bars: A–B = 0.1 mm; C–E = 0.5 mm.

opencc-by-4.0Dec 2017View details →
zenodo40/100

Figure 83. Cicurina wusanani Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China

Figure 83. Cicurina wusanani Li, sp. nov., holotype, male. A. Left pedipalpus, prolateral view. B. Left pedipalpus, retrolateral view. Scale bar = 0.1 mm.

opencc-by-4.0Dec 2017View details →
zenodo40/100

Figure 74. Cicurina kailiensis Li in New cave-dwelling spiders of the family Dictynidae (Arachnida: Araneae) from Guangxi and Guizhou, China

Figure 74. Cicurina kailiensis Li, sp. nov., holotype, male. A. Left pedipalpus, ventral view. B. Palp bulb, ventral view. Scale bars = 0.1 mm.

opencc-by-4.0Dec 2017View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record