Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
1,117
datasets available to search
ShareScore release 0.9.0
Dataset results
1,117 results for “Verbascum”
Verbascum thapsus (Scrophulariaceae) - leaf - basal or on lower stem
Image of Verbascum thapsus (Scrophulariaceae) - leaf - basal or on lower stem
Verbascum thapsus (Scrophulariaceae) - whole plant - juvenile
Image of Verbascum thapsus (Scrophulariaceae) - whole plant - juvenile
Table 1 in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula
<p><b>Table 1.</b> PCR Primers used for amplification in DNA regions.</p><table><tbody><tr><th>Region</th><th>Primer</th><th>Sequence (5′–3′)</th><th>Reference</th></tr></tbody><tbody><tr><th><i>rbcL</i></th><td>rbcLa-F rbcLa-R</td><td>ATGTCACCACAAACAGAGACTAAAGC GTAAAATCAAGTCCACCRCG</td><td>Levin & al. (2003)</td></tr><tr><th><i>matK</i></th><td>matK472F matK1248R</td><td>CCCRTYCATCTGGAAATCTTGGTTC GCTRTRATAATGAGAAAGATTTCTGC</td><td>Yu & al. (2011)</td></tr><tr><th><i>trnL</i></th><td>trnL-f trnL-c</td><td>ATTTGAACTGGTGACACGAG CGAAATCGGTAGACGCTACG</td><td>Taberlet & al. (1991)</td></tr><tr><th>ITS</th><td>ITS2F ITS3R</td><td>ATGCGATACTTGGTGTGAAT GACGCTTCTCCAGACTACAAT</td><td>Chen & al. (2010)</td></tr></tbody></table>
Verbascum thapsus (Scrophulariaceae) - fruit - lateral or general close-up
Image of Verbascum thapsus (Scrophulariaceae) - fruit - lateral or general close-up
Fig. 1 in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula
Fig. 1. Bayesian majority-rule (50%) consensus tree of the combined chloroplast and ITS sequence data matrix. Support values on branches are Bayesian posterior probability/maximum parsimony bootstrap. Clades and species (including study samples) are colour-coded; their geographic distribution is indicated in Fig. 2.
FIG. 3 in A new species of Verbascum L. (Scrophulariaceae) from the Gilan province (Iran), based on morphological and molecular evidences
FIG. 3. — Distance based trees on morphological (left) and genetic (right) characters used to differentiate species of Verbascum parsana Sotoodeh, Attar & Civeyrel, sp. nov., V. punalense Boiss. & Buhse and V. shahsavarensis Sotoodeh, Attar & Civeyrel.
FIG. 1 in A new species of Verbascum L. (Scrophulariaceae) from the Gilan province (Iran), based on morphological and molecular evidences
FIG. 1. — Verbascum parsana Sotoodeh, Attar & Civeyrel, sp. nov.: A, herbarium specimen; B, C, a part of inflorescence and fruits, bract and no bracteole; D, co- rolla and androecium; E, arrows show two anterior anthers. Photographs from the type specimen by A. Sotoodeh. Scale bars: 1 cm.
FIG. 2 in A new species of Verbascum L. (Scrophulariaceae) from the Gilan province (Iran), based on morphological and molecular evidences
FIG. 2. — Distribution of Verbascum parsana Sotoodeh, Attar & Civeyrel, sp. nov. (ê) The magnified view on the right is from Google map (maps.google.com).
Table 2. A in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula
<p><b>Table 2.</b> A comparison of the individual and combined datasets from parsimony analysis.</p><table><tbody><tr><th></th><th>ITS</th><th><i>matK</i></th><th><i>rbcL</i></th><th><i>trnL</i></th><th>Combined chloroplastic</th><th>Combined chloroplastic and ITS</th></tr></tbody><tbody><tr><th>No. of sequences</th><td>62</td><td>62</td><td>62</td><td>62</td><td>62</td><td>62</td></tr><tr><th>Alignment length (bp)</th><td>449</td><td>735</td><td>561</td><td>819</td><td>2115</td><td>2564</td></tr><tr><th>No. of variable characters (%)</th><td>239 (53.2)</td><td>16 (2.1)</td><td>7 (1.2)</td><td>16 (2.3)</td><td>39 (1.8)</td><td>375 (14.6)</td></tr><tr><th>No. of informative characters (%)</th><td>50 (11.1)</td><td>54 (7.3)</td><td>10 (1.7)</td><td>35 (4.2)</td><td>99 (4.6)</td><td>342 (13.3)</td></tr><tr><th>No. of most equally parsimonious trees</th><td>10,000</td><td>7</td><td>6</td><td>1455</td><td>390</td><td>10,000</td></tr><tr><th>Tree length</th><td>380</td><td>73</td><td>20</td><td>58</td><td>156</td><td>939</td></tr><tr><th>Consistency index</th><td>0.8763</td><td>0.9726</td><td>1.0000</td><td>0.9310</td><td>0.9295</td><td>0.8807</td></tr><tr><th>Retention index</th><td>0.8309</td><td>0.9835</td><td>1.0000</td><td>0.9728</td><td>0.9618</td><td>0.8724</td></tr><tr><th>Rescaled consistency index</th><td>0.7282</td><td>0.9565</td><td>1.0000</td><td>0.9057</td><td>0.8940</td><td>0.7684</td></tr></tbody></table>
Verbascum thapsus (Scrophulariaceae) - leaf - basal or on lower stem
Image of Verbascum thapsus (Scrophulariaceae) - leaf - basal or on lower stem
Verbascum thapsus (Scrophulariaceae) - inflorescence - whole - unspecified
Image of Verbascum thapsus (Scrophulariaceae) - inflorescence - whole - unspecified
Fig. 2 in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula
Fig. 2. Distribution of the clades and species, colours correspond to those used in Fig. 1.
Biogeographic differences in plant-soil biota relationships contribute to the invasion exotic range expansion of Verbascum thapsus
<ol> <li><span>Exotic plant species can evolve adaptations to environmental conditions in the exotic range. Furthermore, soil biota can foster exotic spread in the absence of negative soil pathogen-plant interactions or because of increased positive soil biota-plant feedbacks in the exotic range. Little is known, however, about the evolutionary dimension of plant-soil biota interactions when comparing native and introduced ranges.</span></li> <li><span>To assess the role of soil microbes for rapid evolution in plant invasion, we subjected <i>Verbascum thapsus</i>, a species native to Europe, to a reciprocal transplant experiment with soil and seed material originating from Germany (native) and New Zealand (exotic). Soil samples were treated with biocides to distinguish between effects of soil fungi and bacteria. Seedlings from each of five native and exotic populations were transplanted into soil biota communities originating from all populations and subjected to treatments of soil biota reduction: application of (i) fungicide, (ii) biocide, (iii) a combination of the two and (iv) control. </span></li> <li><span>For most of the investigated traits, native populations showed higher performance than exotic populations; there was no effect of soil biota origin. However, plants developed longer leaves and larger rosettes when treated with their respective home soil communities, indicating that native and exotic plant populations differed in their interaction with soil biota origin. The absence of fungi and bacteria resulted in a higher specific root length, suggesting that <i>V. thapsus</i> may compensate the absence of mutualistic microbes by increasing its root-soil surface contact.<b> </b></span></li> <li><span><b>Synthesis. </b>Introduced plants can evolve adaptations to soil biota in their new distribution range. This demonstrates the importance of biogeographic differences in plant-soil biota relationships and suggests that future studies addressing evolutionary divergence should account for differential effects of soil biota from the home and exotic range on native and exotic populations of successful plant invaders. </span></li> </ol>
Biogeographic differences in plant-soil biota relationships contribute to the invasion exotic range expansion of Verbascum thapsus
Open the record for dataset details and reuse information.
Kellogg Biological Station site, station Kellogg Biological Station, study of aboveground net primary productivity of Verbascum thapsus in units of gramsPerMeterSquaredPerYear on a yearly timescale
The EcoTrends project was established in 2004 by Dr. Debra Peters (Jornada Basin LTER, USDA-ARS Jornada Experimental Range) and Dr. Ariel Lugo (Luquillo LTER, USDA-FS Luquillo Experimental Forest) to support the collection and analysis of long-term ecological datasets. The project is a large synthesis effort focused on improving the accessibility and use of long-term data. At present, there are ~50 state and federally funded research sites that are participating and contributing to the EcoTrends project, including all 26 Long-Term Ecological Research (LTER) sites and sites funded by the USDA Agriculture Research Service (ARS), USDA Forest Service, US Department of Energy, US Geological Survey (USGS) and numerous universities. Data from the EcoTrends project are available through an exploratory web portal (http://www.ecotrends.info). This web portal enables the continuation of data compilation and accessibility by users through an interactive web application. Ongoing data compilation is updated through both manual and automatic processing as part of the LTER Provenance Aware Synthesis Tracking Architecture (PASTA). The web portal is a collaboration between the Jornada LTER and the LTER Network Office. The following dataset from Kellogg Biological Station (KBS) contains aboveground net primary productivity of Verbascum thapsus measurements in gramsPerMeterSquaredPerYear units and were aggregated to a yearly timescale.
Cedar Creek Ecosystem Science Reserve site, station Old Field 21 at Cedar Creek, study of plant cover of Verbascum thapsus in units of percent on a yearly timescale
The EcoTrends project was established in 2004 by Dr. Debra Peters (Jornada Basin LTER, USDA-ARS Jornada Experimental Range) and Dr. Ariel Lugo (Luquillo LTER, USDA-FS Luquillo Experimental Forest) to support the collection and analysis of long-term ecological datasets. The project is a large synthesis effort focused on improving the accessibility and use of long-term data. At present, there are ~50 state and federally funded research sites that are participating and contributing to the EcoTrends project, including all 26 Long-Term Ecological Research (LTER) sites and sites funded by the USDA Agriculture Research Service (ARS), USDA Forest Service, US Department of Energy, US Geological Survey (USGS) and numerous universities. Data from the EcoTrends project are available through an exploratory web portal (http://www.ecotrends.info). This web portal enables the continuation of data compilation and accessibility by users through an interactive web application. Ongoing data compilation is updated through both manual and automatic processing as part of the LTER Provenance Aware Synthesis Tracking Architecture (PASTA). The web portal is a collaboration between the Jornada LTER and the LTER Network Office. The following dataset from Cedar Creek Ecosystem Science Reserve (CDR) contains plant cover of Verbascum thapsus measurements in percent units and were aggregated to a yearly timescale.
Cedar Creek Ecosystem Science Reserve site, station Old Field B 22a,b at Cedar Creek, study of plant cover of Verbascum thapsus in units of percent on a yearly timescale
The EcoTrends project was established in 2004 by Dr. Debra Peters (Jornada Basin LTER, USDA-ARS Jornada Experimental Range) and Dr. Ariel Lugo (Luquillo LTER, USDA-FS Luquillo Experimental Forest) to support the collection and analysis of long-term ecological datasets. The project is a large synthesis effort focused on improving the accessibility and use of long-term data. At present, there are ~50 state and federally funded research sites that are participating and contributing to the EcoTrends project, including all 26 Long-Term Ecological Research (LTER) sites and sites funded by the USDA Agriculture Research Service (ARS), USDA Forest Service, US Department of Energy, US Geological Survey (USGS) and numerous universities. Data from the EcoTrends project are available through an exploratory web portal (http://www.ecotrends.info). This web portal enables the continuation of data compilation and accessibility by users through an interactive web application. Ongoing data compilation is updated through both manual and automatic processing as part of the LTER Provenance Aware Synthesis Tracking Architecture (PASTA). The web portal is a collaboration between the Jornada LTER and the LTER Network Office. The following dataset from Cedar Creek Ecosystem Science Reserve (CDR) contains plant cover of Verbascum thapsus measurements in percent units and were aggregated to a yearly timescale.
Cedar Creek Ecosystem Science Reserve site, station Old Field 24 at Cedar Creek, study of plant biomass of Verbascum thapsus in units of gramsPerSquareMeter on a yearly timescale
The EcoTrends project was established in 2004 by Dr. Debra Peters (Jornada Basin LTER, USDA-ARS Jornada Experimental Range) and Dr. Ariel Lugo (Luquillo LTER, USDA-FS Luquillo Experimental Forest) to support the collection and analysis of long-term ecological datasets. The project is a large synthesis effort focused on improving the accessibility and use of long-term data. At present, there are ~50 state and federally funded research sites that are participating and contributing to the EcoTrends project, including all 26 Long-Term Ecological Research (LTER) sites and sites funded by the USDA Agriculture Research Service (ARS), USDA Forest Service, US Department of Energy, US Geological Survey (USGS) and numerous universities. Data from the EcoTrends project are available through an exploratory web portal (http://www.ecotrends.info). This web portal enables the continuation of data compilation and accessibility by users through an interactive web application. Ongoing data compilation is updated through both manual and automatic processing as part of the LTER Provenance Aware Synthesis Tracking Architecture (PASTA). The web portal is a collaboration between the Jornada LTER and the LTER Network Office. The following dataset from Cedar Creek Ecosystem Science Reserve (CDR) contains plant biomass of Verbascum thapsus measurements in gramsPerSquareMeter units and were aggregated to a yearly timescale.
Cedar Creek Ecosystem Science Reserve site, station Old Field 24 at Cedar Creek, study of plant cover of Verbascum thapsus in units of percent on a yearly timescale
The EcoTrends project was established in 2004 by Dr. Debra Peters (Jornada Basin LTER, USDA-ARS Jornada Experimental Range) and Dr. Ariel Lugo (Luquillo LTER, USDA-FS Luquillo Experimental Forest) to support the collection and analysis of long-term ecological datasets. The project is a large synthesis effort focused on improving the accessibility and use of long-term data. At present, there are ~50 state and federally funded research sites that are participating and contributing to the EcoTrends project, including all 26 Long-Term Ecological Research (LTER) sites and sites funded by the USDA Agriculture Research Service (ARS), USDA Forest Service, US Department of Energy, US Geological Survey (USGS) and numerous universities. Data from the EcoTrends project are available through an exploratory web portal (http://www.ecotrends.info). This web portal enables the continuation of data compilation and accessibility by users through an interactive web application. Ongoing data compilation is updated through both manual and automatic processing as part of the LTER Provenance Aware Synthesis Tracking Architecture (PASTA). The web portal is a collaboration between the Jornada LTER and the LTER Network Office. The following dataset from Cedar Creek Ecosystem Science Reserve (CDR) contains plant cover of Verbascum thapsus measurements in percent units and were aggregated to a yearly timescale.
Cedar Creek Ecosystem Science Reserve site, station Old Field 27 at Cedar Creek, study of plant cover of Verbascum thapsus in units of percent on a yearly timescale
The EcoTrends project was established in 2004 by Dr. Debra Peters (Jornada Basin LTER, USDA-ARS Jornada Experimental Range) and Dr. Ariel Lugo (Luquillo LTER, USDA-FS Luquillo Experimental Forest) to support the collection and analysis of long-term ecological datasets. The project is a large synthesis effort focused on improving the accessibility and use of long-term data. At present, there are ~50 state and federally funded research sites that are participating and contributing to the EcoTrends project, including all 26 Long-Term Ecological Research (LTER) sites and sites funded by the USDA Agriculture Research Service (ARS), USDA Forest Service, US Department of Energy, US Geological Survey (USGS) and numerous universities. Data from the EcoTrends project are available through an exploratory web portal (http://www.ecotrends.info). This web portal enables the continuation of data compilation and accessibility by users through an interactive web application. Ongoing data compilation is updated through both manual and automatic processing as part of the LTER Provenance Aware Synthesis Tracking Architecture (PASTA). The web portal is a collaboration between the Jornada LTER and the LTER Network Office. The following dataset from Cedar Creek Ecosystem Science Reserve (CDR) contains plant cover of Verbascum thapsus measurements in percent units and were aggregated to a yearly timescale.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.