Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

152

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

152 results for “Serrasalmidae”

Learn how ShareScore rates datasets ↗
zenodo32/100

FIGURE 6 in Taxonomic revision of the Cis-Andean species of Mylossoma Eigenmann & Kennedy, 1903 (Teleostei: Characiformes: Serrasalmidae)

FIGURE 6. Mylossoma albiscopum, radiograph of the lectotype of Myletes albiscopus, ANSP 8021, showing (a) premaxilla projected forward, (b) first dorsal-fin ray reduced in size and (c) ventral serra attached to the anal fin or almost so. Radiography by Kyle Luckenbill.

opennotspecifiedFeb 2018View details →
zenodo32/100

FIGURE 8. Mylossoma albiscopum, LBP 21833, 95 in Taxonomic revision of the Cis-Andean species of Mylossoma Eigenmann & Kennedy, 1903 (Teleostei: Characiformes: Serrasalmidae)

FIGURE 8. Mylossoma albiscopum, LBP 21833, 95 mm SL, rio Negro, Amazonas, Brazil, specimen freshly collected.

opennotspecifiedFeb 2018View details →
zenodo32/100

FIGURE 1 in Taxonomic revision of the Cis-Andean species of Mylossoma Eigenmann & Kennedy, 1903 (Teleostei: Characiformes: Serrasalmidae)

FIGURE 1. Mylossoma albiscopum, freshly collected, 126 mm SL, Igarapé Belmont, right margin of rio Madeira, downstream the Cachoeira Santo Antônio (nowadays UHE Santo Antônio), 08°38'36''S 63°51'05''W, not preserved. Photo by Bruno Barros.

opennotspecifiedFeb 2018View details →
zenodo32/100

FIGURE 3 in Taxonomic revision of the Cis-Andean species of Mylossoma Eigenmann & Kennedy, 1903 (Teleostei: Characiformes: Serrasalmidae)

FIGURE 3. Geographic distribution of the four Cis-Andean Mylossoma species. One dot may represent more than one locality. Red circles: M. albiscopum; yellow triangles: M. aureum; purple squares: M. duriventre; orange diamonds: M. unimaculatum. Mylossoma aureum is also recorded for the Río Orinoco basin (see text).

opennotspecifiedFeb 2018View details →
zenodo32/100

FIGURE 4 in Taxonomic revision of the Cis-Andean species of Mylossoma Eigenmann & Kennedy, 1903 (Teleostei: Characiformes: Serrasalmidae)

FIGURE 4. Mylossoma albiscopum, lectotype of Myletes albiscopus, ANSP 8021, 160 mm TL, río Ambyiacu, Peru. Right side, reversed. Photo by Kyle Luckenbill.

opennotspecifiedFeb 2018View details →
zenodo32/100

FIGURE 5. Mylossoma albiscopum, LBP 10144, 242 in Taxonomic revision of the Cis-Andean species of Mylossoma Eigenmann & Kennedy, 1903 (Teleostei: Characiformes: Serrasalmidae)

FIGURE 5. Mylossoma albiscopum, LBP 10144, 242 mm SL, rio Abunã, rio Madeira basin, Porto Velho, Rondônia.

opennotspecifiedFeb 2018View details →
zenodo32/100

FIGURE 2 in Taxonomic revision of the Cis-Andean species of Mylossoma Eigenmann & Kennedy, 1903 (Teleostei: Characiformes: Serrasalmidae)

FIGURE 2. Mylossoma albiscopum premaxillary (pmx) and dentary (den), INPA 45467, Careiro da Várzea, lagos do Catalão, Amazonas, Brazil.

opennotspecifiedFeb 2018View details →
zenodo32/100

FIGURE 5 in A new species of Myloplus Gill (Characiformes, Serrasalmidae) from the Tumucumaque Mountain Range, Brazil and French Guiana, with comments on M. rubripinnis

FIGURE 5. Myloplus rubripinnis, Jari River, Amapá, Brazil. A) IEPA 2863, male, 170.0 mm SL; B) IEPA 2891, female, 155.3 mm SL. Scale bars = 10 mm.

opennotspecifiedApr 2018View details →
zenodo32/100

FIGURE 4. A in A new species of Myloplus Gill (Characiformes, Serrasalmidae) from the Tumucumaque Mountain Range, Brazil and French Guiana, with comments on M. rubripinnis

FIGURE 4. A) Myloplus rubripinnis, 76.5 mm SL, paralectotype of Myletes rubripinnis, BMNH 1971.5.10.64, Essequibo River basin, Guyana; B) Myloplus tumukumak, 67.4 mm SL, paratype, MNHN 1981-0423, Camopi River, French Guiana. Scale bars = 10 mm.

opennotspecifiedApr 2018View details →
zenodo32/100

FIGURE 2. Myloplus tumukumak, IRSNB 20.223 in A new species of Myloplus Gill (Characiformes, Serrasalmidae) from the Tumucumaque Mountain Range, Brazil and French Guiana, with comments on M. rubripinnis

FIGURE 2. Myloplus tumukumak, IRSNB 20.223, paratype, 45.9 mm SL, Camopi River, Oyapock River basin, French Guiana. Scale bar = 10 mm.

opennotspecifiedApr 2018View details →
zenodo32/100

FIGURE 3 in A new species of Myloplus Gill (Characiformes, Serrasalmidae) from the Tumucumaque Mountain Range, Brazil and French Guiana, with comments on M. rubripinnis

FIGURE 3. Distribution map of Myloplus tumukumak (black circles; black star represent type locality), and Myloplus rubripinnis (white circles). The Tumuk-Humak Mountain Range is represented in gray shade. Symbols can represent more than one record.

opennotspecifiedApr 2018View details →
zenodo32/100

FIGURE 1. Myloplus tumukumak, ZMA 107.638 in A new species of Myloplus Gill (Characiformes, Serrasalmidae) from the Tumucumaque Mountain Range, Brazil and French Guiana, with comments on M. rubripinnis

FIGURE 1. Myloplus tumukumak, ZMA 107.638, holotype, 215.3 mm SL, Motoura River, Oyapock River basin, State of Amapá, Brazil: photo (A) and x-ray (B), with yellow arrow indicating pectoral-fin origin, and white arrow the anteriormost spine of prepelvic serra. Scale bars = 10 mm.

opennotspecifiedApr 2018View details →
zenodo32/100

PLATE 2 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 2. Serrasalmus manueli (10) and S. gouldingi (11–15). (Photographs of S. gouldingi specimens 12 and 14 by Donald Taphorn.)

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 7 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 7. Phylogenetic trees of serrasalmids inferred from ribosomal (A) and control region (B) data sets, both including original material and GenBank sequences. Parsimony bootstrap percentages are shown above branch nodes, while proportions (>50%) of trees possessing a given clade in Bayesian posterior distributions are shown below. Taxa shared by both trees are in bold font. Specimen sequences from original material appear in shadow boxes, preceding numbers (1-33) correspond to numbered specimens and information presented in Table 1 and elsewhere. GenBank sequences are followed by gb. Taxa with VNTR in control region marked by an "R" and reconstruction of presence of VNTR shown in blue. GenBank (gb) species with asterisk (*) indicate taxa of which we question the identification.

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 6. Primers used for amplifying and sequencing the control region and adjacent tRNAs. Internal primers 5'-3': 662F – ACCATGCCAAGGCGTTCTTT, 662R – AAAGAACGCCTTGGCATGGT, 724F – ACATTTGGTCACTTTCG- GAGA, 462R – CGGTTGGTGGTCTCTTACTACA, F-TTF2 – CGCCACCAGAAAAGAGAGAT, and F-12R2 - GCCCGTGGAACTTTCTAGG

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 5 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 5. Serrasalmus irritans (24), Pygocentrus cariba (25), and Pygopristis denticulatus (27). (No photograph or voucher available for specimen 26.)

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 1. Alternative hypotheses of serrasalmid relationships: (A) Machado-Allison (1983, 1985), based on morphology, divides family into two major clades; (B) Machado-Allison et al. (1989) revised piranha clade showing the position of Pristobrycon striolatus if absence of pre-anal spine is considered to be primitive character (arrow indicates occurrence of this trait); (C) Ortí et al. (1996), based on mitochondrial ribosomal RNA sequence data, defines three major clades. Upper tree includes 13 of the currently 15 recognized genera, lower tree includes 11 genera. Note: the genus Tometes was presented in original tree of Ortí et al. (1996) as "N. gen. A" (P. Petry, pers. comm. 2005). The authors also stated that specimens assigned by Machado-Allison (1982, 1983) to Utiaritichthys do not belong to that genus, apparently suggesting the specimens are Tometes.

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 6 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 6. Pristobrycon striolatus (28–31) and additional small juvenile specimens collected with genetic vouchers showing life colors.

opennotspecifiedMay 2007View details →
zenodo32/100

FIGURE 3 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

FIGURE 3. Diet and intestinal length data mapped onto Machado-Allison's (1985) proposed phylogeny (modified from Nico 1991). Diet data based on 18 serrasalmid species from the Orinoco River basin (Venezuela); number in parentheses following generic name represents numbers of species in each genus included in study; Jv = juvenile trait; ad = adult trait; long intestine defined as mean intestine length>1.2 X standard length.

opennotspecifiedMay 2007View details →
zenodo32/100

PLATE 1 in Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories

PLATE 1. Serrasalmus manueli (1–9). (No photograph or voucher available for specimen 3.) (Photograph of 8-S. manueli by Frank Pezold.)

opennotspecifiedMay 2007View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record