Find research datasets worth reusing

opencc-by-4.0Oct 2006View details →

Figure 1 in Molecular identification, description, and phylogenetic implications of the tadpoles of 11 species of Malagasy treefrogs, genus Boophis

Figure 1. Drawings of the tadpole of Boophis boehmei (ZSM 534/2004). (a) Dorsal view; (b) lateral view; (c) oral disc.

opencc-by-4.0Oct 2006View details →

Figure 2 in Molecular identification, description, and phylogenetic implications of the tadpoles of 11 species of Malagasy treefrogs, genus Boophis

Figure 2. Drawings of the tadpole of Boophis reticulatus (ZSM 525/2004). (a) Dorsal view; (b) lateral view; (c) oral disc.

Fig. 11 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 11. Projections of factor 1 (x-axis) and factor 2 (y-axis) in principal component analysis of A, cranial measurements and B, dental measurements of different diminutive species of Miniopterus from Madagascar, all of which were previously considered to be M. manavi, as well as M. petersoni. Loadings of variables on each axis are shown in table 6.

Fig. 10 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 10. Lateral views of skulls and mandibles of Miniopterus spp. from Madagascar: (above, from left to right) M. manavi (FMNH 194074) from the Grotte de Fandanana, near Fandriana; M. griveaudi (FMNH 169712) from near the Andrafiabe Cave, Ankarana; holotype of M. aelleni (FMNH 173067), from the Canyon d'Antsiroandoa, Ankarana; (below, left) holotype of M. brachytragos (FMNH 175840), from the Forêt d'Ambovonomby, Parc National de Namoroka, Forêt d'Ambovonomby; and (below, right) holotype of M. mahafaliensis (FMNH 173197), from near Mitoho Cave, Parc National de Tsimanampetsotsa. (Photograph taken by J. Weinstein, Field Museum image number Z94488_03d.)

Fig. 8 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 8. Dorsal views of skulls of Miniopterus spp. from Madagascar: (above, from left to right) M. manavi (FMNH 194074) from the Grotte de Fandanana, near Fandriana; M. griveaudi (FMNH 169712) from near the Andrafiabe Cave, Ankarana; holotype of M. aelleni (FMNH 173067), from the Canyon d'Antsiroandoa, Ankarana; below, left) holotype of M. brachytragos (FMNH 175840), from the Forêt d'Ambovonomby, Parc National de Namoroka; and (below, right) holotype of M. mahafaliensis (FMNH 173197), from near Mitoho Cave, Parc National de Tsimanampetsotsa. (Photograph taken by J. Weinstein, Field Museum image number Z94488_01d.)

Fig. 7 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 7. Different views of skull and mandible of the holotype of Miniopterus mahafaliensis (FMNH 173197) collected in the Parc National de Tsimanampetsotsa, 6.5 km NE Efoetse, near Mitoho Cave: (above, left) dorsal view of cranium; (above, right) ventral view of cranium; and (below) lateral view of cranium and mandible. (Photograph taken by John Weinstein, Field Museum image number Z94487_05d.)

Fig. 6 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 6. Photograph of living Miniopterus mahafaliensis captured 6.5 km NE Efoetse, near Mitoho Cave, Parc National de Tsimanampetsotsa (FMNH 173191), taken at the same locality as the holotype (FMNH 173197). Note the gray grizzled hair to the ventrum. (Photograph by Harald Schütz.)

Fig. 5 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 5. Different views of skull and mandible of the holotype of Miniopterus brachytragos (FMNH 175840) collected in the Parc National de Namoroka, Forêt d'Ambovonomby, 26 km NW Andranomavo: (above, left) dorsal view of cranium; (above, right) ventral view of cranium; and (below) lateral view of cranium and mandible. (Photograph taken by John Weinstein, Field Museum image number Z94486_05d.)

Fig. 9 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 9. Ventral views of skulls of Miniopterus spp. from Madagascar: (above, from left to right) M. manavi (FMNH 194074) from the Grotte de Fandanana, near Fandriana; M. griveaudi (FMNH 169712) from near the Andrafiabe Cave, Ankarana; holotype of M. aelleni (FMNH 173067), from the Canyon d'Antsiroandoa, Ankarana; (below, left) holotype of M. brachytragos (FMNH 175840), from the Forêt d'Ambovonomby, Parc National de Namoroka, Forêt d'Ambovonomby; and (below, right) holotype of M. mahafaliensis (FMNH 173197), from near Mitoho Cave, Parc National de Tsimanampetsotsa. (Photograph taken by J. Weinstein, Field Museum image number Z94488_02d.)

Fig. 4 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 4. Right ear and tragus of Miniopterus spp. from Madagascar: A, M. brachytragos (FMNH 175840, holotype), from Parc National de Namoroka, Forêt d'Ambovonomby, 26 km NW Andranomavo; B, M. brachytragos (FMNH 172685) from the Forêt de Binara, near Analamazava River, 7.5 km SW Daraina (village); C, M. brachytragos (FMNH 202523) from 1.8 km S Ambanizana, Masoala Peninsula; D, M. mahafaliensis (FMNH 173197, holotype) from Parc National de Tsimanampetsotsa, 6.5 km NE Efoetse, near Mitoho Cave; E, M. mahafaliensis (FMNH 176101) from Parc National de Kirindy-Mite, near village of Betakilotra, 11 km SE Marofihitsa; F, M. griveaudi (FMNH 184055) from Beloboka, grotte n°1, 12.5 km E Mahajanga, Madagascar; G, M. aelleni (FMNH 175842) from the Parc National de Namoroka, Forêt d'Ambovonomby, 26 km NW Andranomavo. The slightly elongated and pointed distal portion of the tragus in FMNH 175840 (A), as compared to FMNH 172685 and FMNH 202523, maybe an anomalous shape in M. brachytragos.

Fig. 1 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 1. Map of Madagascar showing localities mentioned in the text and sites where specimens of Miniopterus brachytragos sp. nov., M. mahafaliensis sp. nov., M. manavi sensu stricto, M. petersoni, M. griveaudi, and M. aelleni have been collected. The latter two species are also known from the Comoro Archipelago (Goodman et al., 2009b). The species symbols for the sites of Namoroka and Bemaraha have been slightly spread out to avoid obscuring information.

Fig. 2 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 2. Phylogenetic position of different Miniopterus spp. Miniopterus fuliginosus was selected as the outgroup. The tree presented was produced using Bayesian analysis. Posterior probabilities (Bayesian

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

opencc-by-4.0Feb 2017View details →

Fig. 2. The two Gerarda prevostiana specimens collected 1 in Further specimens of the mud snake, Gerarda prevostiana (Homalopsidae) from Sri Lanka with insights from molecular phylogenetics

Fig. 2. The two Gerarda prevostiana specimens collected 1 km offshore from Vankale, Mannar, Sri Lanka. 2013.18.01.NH: A, C, E, G, I, K; 2013.19.01.NH: B, D, F, H, J, L. Scale bar is 3 mm. Dorsal (A, B), lateral (C, D) and ventral (E, F) aspect of the heads. Dorsal (G, H), lateral (I, J) and ventral (K, L) aspect of mid-body.

opencc-by-4.0Feb 2017View details →

Fig. 3 in Further specimens of the mud snake, Gerarda prevostiana (Homalopsidae) from Sri Lanka with insights from molecular phylogenetics

Fig. 3. Bayesian majority-rule consensus tree based on Cytochrome b gene showing the phylogenetic relationships of Sri Lankan Gerarda prevostiana. The scale bar indicates the number of substitutions per site. Black circles indicate node support of Bayesian posterior probability>0.9 and ML bootstrap support>70. Outgroup Xenochrophis vittatus is not shown.