Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
4,144
datasets available to search
ShareScore release 0.9.0
Dataset results
4,144 results for “ITS barcode”
Figure 14 Periglischrus paravargasi, female. A in DNA barcoding, visual-guide resource, new localities and host associations of genus Periglischrus Oudemans, 1902 (Acari: Mesostigmata, Spinturnicidae) from Minas Gerais, Brazil
Figure 14 Periglischrus paravargasi, female. A – General view; B – Mediodistal lobe of palpal tibia indicated in red arrow; C – Dorsal plate with proteronotal setae (Pn1–Pn5) and poststigmal seta (Pst) indicated; D – Dorsal opisthosoma with hysteronotal setae (Op1–Op6) indicated
Figure 15 Periglischrus paravargasi, male. A in DNA barcoding, visual-guide resource, new localities and host associations of genus Periglischrus Oudemans, 1902 (Acari: Mesostigmata, Spinturnicidae) from Minas Gerais, Brazil
Figure 15 Periglischrus paravargasi, male. A – General view; B – Dorsal view with proteronotal setae (Pn1–Pn5) and poststigmal seta (Pst) indicated; C – Ventral view with sternogenital setaeSt(1–St4) and genital seta (Sg) indicated; D – Ventral setae on legs I and II with details; E Details ventral setae on leg I; F – Details ventral setae on leg II; G – Coxa I with pv anddvsetae, indicated in red arrow; H – Femur–tibia I with proximal adsetae, indicated; I – Coxa II with posterolateral setapl () indicated; J – Femur II, proximaladandpdsetae, indicated; K – Proximal adandpd on tarsus III, indicated; L – Femur IV, proximaladandpd setae, indicated; M – Genu IV, proximaladandpd setae, indicated; N – proximal adandpd on tarsus IV, indicated. Scale bars: A = 200 µm, B–D and H = 100 µm, E–G, I–N = 50 µm.
Figures 13-18. Chrysodeixis chalcites Esper 13. Forewing, 14. Hindwing, 15 in Status of Chrysodeixis chalcites Esper and Chrysodeixis eriosoma (Doubleday) of family Noctuidae (Lepidoptera) in India as determined by DNA barcoding and morphological characterization
Figures 13-18. Chrysodeixis chalcites Esper 13. Forewing, 14. Hindwing, 15. Eight photos of forewing spots; Chrysodeixis acuta (Walker) – 16. Forewing, 17. Hindwing, 18. Eight photos of forewing spots.
Figures 7-12. Chrysodeixis chalcites Esper 7 in Status of Chrysodeixis chalcites Esper and Chrysodeixis eriosoma (Doubleday) of family Noctuidae (Lepidoptera) in India as determined by DNA barcoding and morphological characterization
Figures 7-12. Chrysodeixis chalcites Esper 7. Habitus photograph of male, 8. Habitus photograph of female, 9. Male genitalia attached with aedeagus, 10. Male genitalia, 11. Female genitalia, 12. Aedeagus.
Figures 1-6 in Status of Chrysodeixis chalcites Esper and Chrysodeixis eriosoma (Doubleday) of family Noctuidae (Lepidoptera) in India as determined by DNA barcoding and morphological characterization
Figures 1-6. Chrysodeixis acuta (Walker) 1. Habitus photograph of male, 2. Habitus photograph of female, 3. Male genitalia attached with aedeagus, 4. Male genitalia, 5. Female genitalia, 6. Aedeagus.
Table 1 in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula
<p><b>Table 1.</b> PCR Primers used for amplification in DNA regions.</p><table><tbody><tr><th>Region</th><th>Primer</th><th>Sequence (5′–3′)</th><th>Reference</th></tr></tbody><tbody><tr><th><i>rbcL</i></th><td>rbcLa-F rbcLa-R</td><td>ATGTCACCACAAACAGAGACTAAAGC GTAAAATCAAGTCCACCRCG</td><td>Levin & al. (2003)</td></tr><tr><th><i>matK</i></th><td>matK472F matK1248R</td><td>CCCRTYCATCTGGAAATCTTGGTTC GCTRTRATAATGAGAAAGATTTCTGC</td><td>Yu & al. (2011)</td></tr><tr><th><i>trnL</i></th><td>trnL-f trnL-c</td><td>ATTTGAACTGGTGACACGAG CGAAATCGGTAGACGCTACG</td><td>Taberlet & al. (1991)</td></tr><tr><th>ITS</th><td>ITS2F ITS3R</td><td>ATGCGATACTTGGTGTGAAT GACGCTTCTCCAGACTACAAT</td><td>Chen & al. (2010)</td></tr></tbody></table>
Fig. 36 in COI mtDNA barcoding and morphology for the description of a new species of ricinuleid of the genus Pseudocellus (Arachnida: Ricinulei: Ricinoididae) from El Triunfo Biosphere Reserve, Chiapas, Mexico
Fig. 36. Species of the genus Pseudocellus Platnick, 1980 described from Chiapas, Mexico, including the new species described herein. Star: El Triunfo Biosphere Reserve, El Quetzal Camp, Angel Albino Corzo Municipality. Red circle: Cerro Boquerón, Ejido Boquerón, Motozintla Municipality. Orange circle: Sumidero del Camino, 16 km NE of Comitán. Pink circle: Kolem-chen Cave "Cueva Grande", Chan-kin Reserve, Ocosingo Municipality. Blue circle: San Francisco Cave, La Trinitaria Municipality. Purple circle: Finca Guatimoc, south slope of the Tacaná volcano, 32 km north of Tapachula, near Cacahuatán. Green circle: Las Abejas Cave, San Fernando Municipality.
Fig. 1 in COI mtDNA barcoding and morphology for the description of a new species of ricinuleid of the genus Pseudocellus (Arachnida: Ricinulei: Ricinoididae) from El Triunfo Biosphere Reserve, Chiapas, Mexico
Fig. 1. Neighbour-Joining (NJ) tree with p-distances constructed with COI barcode sequences from different specimens and species of Pseudocellus Platnick, 1980. Colors of the branches indicate species of Pseudocellus already described, red branches indicate the new species. Numbers on the branches represent Bootstrap support values (>50% significant).
Figs 32–35 in COI mtDNA barcoding and morphology for the description of a new species of ricinuleid of the genus Pseudocellus (Arachnida: Ricinulei: Ricinoididae) from El Triunfo Biosphere Reserve, Chiapas, Mexico
Figs 32–35. Pseudocellus giribeti sp. nov. Paratypes (MCZ 80010). 32–33. Deutonymph, habitus, dorsal and ventral views. 34–35. Tritonymph, habitus, dorsal and ventral views. Scale bars = 2 mm.
Figs 20–26 in COI mtDNA barcoding and morphology for the description of a new species of ricinuleid of the genus Pseudocellus (Arachnida: Ricinulei: Ricinoididae) from El Triunfo Biosphere Reserve, Chiapas, Mexico
Figs 20–26. Pseudocellus giribeti sp. nov. Holotype, ♂ (MCZ 80010). 20–22. Right leg III (copulatory apparatus), retrolateral, prolateral and dorsal views. 23. Copulatory apparatus extended, prolateral view. 24. Copulatory apparatus, dorsal view. 25. Copulatory apparatus, prolateral view. 26. Tarsal process, distal half, prodorsal view. Scale bars: 20–22 = 0.5 mm; 23–25 = 0.2 mm; 26 = 0.1 mm.
Figs 7–10 in COI mtDNA barcoding and morphology for the description of a new species of ricinuleid of the genus Pseudocellus (Arachnida: Ricinulei: Ricinoididae) from El Triunfo Biosphere Reserve, Chiapas, Mexico
Figs 7–10. Pseudocellus giribeti sp. nov. Holotype, ♂ (MCZ 80010). 7–8. Opisthosoma, dorsal and ventral views. 9. Tergite XI, median plate (arrow indicates the lateral depression). 10. Pygidium, posterior view. Scale bars: 7–8 = 1 mm; 9 = 0.5 mm; 10 = 0.2 mm.
Figs 3–6 in COI mtDNA barcoding and morphology for the description of a new species of ricinuleid of the genus Pseudocellus (Arachnida: Ricinulei: Ricinoididae) from El Triunfo Biosphere Reserve, Chiapas, Mexico
Figs 3–6. Pseudocellus giribeti sp. nov. Holotype, ♂ (MCZ 80010). 3–4. Habitus, dorsal and ventral views. 5. Carapace, dorsal view. 6. Prosoma, ventral view, showing coxosternal region. Scale bars: 3–4 = 2 mm; 5–6 = 0.5 mm.
Fig. 6 in DNA barcoding of some Pandeidae species (Cnidaria, Hydrozoa, Anthoathecata)
Fig. 6. Neoturris pileata, preserved specimen (MHNG-INVE-35522) from the Mediterranean, collected before 1895 and identified by C. Hartlaub. Note that the bell shape is not elongated as often seen in other illustrations (e.g. Fig. 7), but nevertheless lies within the range of variation for Mediterranean specimens. Moreover, the bell is somewhat flattened in this preserved sample.
Fig. 1 in Occurrence and Molecular Barcode of the Freshwater Heteronemertean Apatronemertes albimaculosa (Nemertea: Pilidiophora) from Japan
Fig. 1. Apatronemertes albimaculosa Wilfert and Gibson, 1974, ICHUM 5113 (A, B), 5112 (C), photographs taken in life. A, Entire body; B, magnification of body surface in intestinal region, showing minute oval inclusions in epidermis, these appearing white with lateral strobe illumination; C, anterior region.
Fig. 4. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 4. A maximum-likelihood phylogenetic tree of the genus Hymenolepis. The tree was made with sequences of mitochondrial cox1 (456 nucleotide sites) under the substitutional model GTR+G+I. The isolates of this study (18AK285, 19AK270, H22B, JA173, JA175, JA220, and JA244) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Rodentolepis nana (accession no. LC063187) was used as an outgroup taxon.
Fig. 8. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 8. A maximum-likelihood phylogenetic tree of the genus Catenotaenia. The tree was made with 28S rDNA sequences (1208 nucleotide sites) under the substitutional model GTR+G. The isolates of this study (AMU, JA212, and JA317) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Hymenolepis diminuta (accession no. AY157181) was used as an outgroup taxon.
Fig. 3 in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 3. Adult tapeworms of Hymenolepis sp. 1, Arostrilepis tenuicirrosa, and Microsomacanthus sp. A, Scolex of Hymenolepis sp. 1; B, mature proglottids of Hymenolepis sp. 1; C, scolex of A. tenuicirrosa; D, mature proglottid of A. tenuicirrosa; E, gravid proglottid of A. tenuicirrosa; F, whole body of Microsomacanthus sp.; G, scolex of Microsomacanthus sp.; H, mature proglottids of Microsomacanthus sp. Scale bars: A, C, G, 200 µm; B, D, 500 µm; E, 1 mm; F, 2 mm; G, 100 µm.
Fig. 6 in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 6. Adult tapeworms of Paranoplocephala kalelai, Catenotaenia sp., and Raillietina sp. A, Scolex of P. kalelai; B, mature proglottid of P. kalelai; C, gravid proglottid of P. kalelai; D, scolex of Catenotaenia sp.; E, mature proglottid Catenotaenia sp.; F, gravid proglottids of Catenotaenia sp.; G, scolex of Raillietina sp.; H, mature proglottids of Raillietina sp. Scale bars: A–C, E, H, 500 µm; D, G, 200 µm; F, 1 mm.
Fig. 5. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 5. A maximum-likelihood phylogenetic tree of the genus Arostrilepis. The tree was made with sequences of mitochondrial cytb (558 nucleotide sites) under the substitutional model GTR+G+I. The isolates of this study (19AK170, 19AK439, 19AK454, and 19AK459) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Hymenolepis diminuta (accession no. AF314223) was used as an outgroup taxon.
Fig. 2. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 2. A maximum likelihood phylogenetic tree of the families Hymenolepididae, Anoplocephalidae, Catenotaeniidae, and Davaineidae. The tree was made with sequences of 28S rDNA (1137 nucleotide sites) under the substitutional model GTR+G. The isolates of this study (19AK270, JA175, 19AK170, JA313, 19AK378, AMU, and Para33SI) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Bootstrap percentages are shown on each node. Scale bar indicates the number of substitutions per nucleotide site. Dibothriocephalus nihonkaiensis (accession no. LC474508) was used as an outgroup taxon.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.