Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
7,883
datasets available to search
ShareScore release 0.9.0
Dataset results
7,883 results for “Tropic”
Data from "The relevance of flash coloration against avian predation in a Morpho butterfly: A field experiment in a tropical rainforest"
<p>This dataset contains all the data related to the manuscript "The relevance of flash coloration against avian predation in a <em>Morpho </em>butterfly: A field experiment in a tropical rainforest". </p>
Table 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
<p><b>Table 1:</b> Details of target genes (<i>hif-1α</i>, <i>hsp70</i>, <i>ras</i>, <i>mstn</i>, <i>acly</i>, <i>per-1</i>, <i>cry-1</i>, <i>ube3a</i> and <i>ogt</i>) and reference genes (<i>β- tubulin</i> and <i>β- actin</i>) primers.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Length (bp)</b></th><th><b>R</b> <b>2</b></th><th><b>Efficiency (%)</b></th><th><b>Primers sequence (5ʹ-3ʹ) forward/reverse</b></th></tr></tbody><tbody><tr><th><i>tubulin</i> -F</th><td>20</td><td>0.99</td><td>109.5</td><td>GACGTGGTGCCCAAAGATGT</td></tr><tr><th><i>tubulin</i> -R</th><td>18</td><td>TGGATGGTGCGCTTGGT</td></tr><tr><th><i>β- actin</i> -F</th><td>21</td><td>0.99</td><td>100.5</td><td>GCTGTTTTCCCCTCCATTGTT</td></tr><tr><th><i>β- actin</i> -R</th><td>19</td><td>TCCCATGCCAACCATCACT</td></tr><tr><th><i>hif-1α</i> -F</th><td>20</td><td>0.99</td><td>105.2</td><td>CTTCTGAGCTCTGATGAGGC</td></tr><tr><th><i>hif-1α</i> -R</th><td>20</td><td>GAAAGCACCATCAGGAAGCC</td></tr><tr><th><i>hsp-70</i> -F</th><td>20</td><td>0.99</td><td>100.9</td><td>GCAAGGAGAACAAGATCACC</td></tr><tr><th><i>hsp-70</i> -R</th><td>19</td><td>CACTCCGTTGCACTTGTCC</td></tr><tr><th><i>mstn</i> -F</th><td>20</td><td>0.98</td><td>100.5</td><td>AATCCAAGCGAGGGAAAAGC</td></tr><tr><th><i>mstn</i> -R</th><td>22</td><td>CCTCCATCACCTGAAAGGTCTT</td></tr><tr><th><i>ras</i> -F</th><td>20</td><td>0.97</td><td>99.31</td><td>CCAGTACATGAGGACAGGAG</td></tr><tr><th><i>ras</i> -R</th><td>20</td><td>CAAGCACCATTGGCACATCG</td></tr><tr><th><i>acly</i> -F</th><td>19</td><td>0.99</td><td>100.7</td><td>ATCATCTCCCGCACTACAG</td></tr><tr><th><i>acly</i> -R</th><td>19</td><td>TACCTCCAATCTCTCCCAG</td></tr><tr><th><i>ube3a</i> -F</th><td>21</td><td>0.98</td><td>103.3</td><td>GCCATAAGCAAGCAGCACAAC</td></tr><tr><th><i>ube3a</i> -R</th><td>19</td><td>CCAGTCAGTCCGCACATCG</td></tr><tr><th><i>per-1</i> -F</th><td>20</td><td>0.98</td><td>104.1</td><td>TGTTGAAGTTTGTGCCCCAG</td></tr><tr><th><i>per-1</i> -R</th><td>18</td><td>CAGTCCAGATGCTCCTCC</td></tr><tr><th><i>cry-1</i> -F</th><td>19</td><td>0.99</td><td>103.6</td><td>GTCCAACAGCCCTCAAACT</td></tr><tr><th><i>cry-1</i> -R</th><td>18</td><td>TACGCCAAGCACTCCAGA</td></tr><tr><th><i>ogt</i> -F</th><td>19</td><td>0.99</td><td>104.1</td><td>CCTCCCTTTGCTGTGTTCC</td></tr><tr><th><i>ogt</i> -R</th><td>20</td><td>TGTCTGCTTTCCGCTTTCGC</td></tr></tbody></table>
Global tropical cyclone size and intensity reconstruction dataset for 1959–2022 based on IBTrACS and ERA5 data
<p>A global long-term tropical cyclone (TC) size and intensity reconstruction dataset is generated, covering a time period from 1959 to 2022, with a 3-hour temporal resolution. The machine learning model was established by taking ERA5-derived 10 m azimuthal mean azimuthal wind profiles in six basins for which TCs were generated as input, while the maximum sustained wind speed and radius of maximum wind from the International Best Track Archive for Climate Stewardship (IBTrACS) was used as the learning target. An empirical wind–pressure relationship and six wind profile models were employed to estimate the minimum central pressure and outer sizes (radial distances from the cyclone center to locations where sustained wind speeds of 34, 50 and 64 knots are observed on surface) of the TCs, respectively. Compared to the IBTrACS dataset, the reconsturction dataset contains approximately 3–4 times more data points per characteristic.</p> <p>Over all, this dataset is in terms of both coverage and good accuracy.</p>
Fig. 3 in Phylogenomics of the tropical plant family Ochnaceae using targeted enrichment of nuclear genes and 250+ taxa
Fig. 3. Continues. For caption, see next part.
Tracing diurnal variations of atmospheric CO2, O2 and δ13CO2 over a tropical and a temperate forest
<p>These are the datasets of the campaigns used in the paper: <em>Tracing diurnal variations of atmospheric CO2, O2 and δ13CO2 over a tropical and a temperate forest. </em>Two campaigns are included: <em>CloudRoots </em>and <em>Loobos</em>. Have a look at the README files on the specifics of what is inside the files and how to cite these datasets. </p> <p> </p>
TABLE 1 in High-quality herbarium-label transcription by citizen scientists improves taxonomic and spatial representation of the tropical plant family Annonaceae
<p>TABLE 1. — Species per dataset and continent.</p><table><tbody><tr><th><b>Region</b></th><th><b>GBIF</b></th><th><b>Herbonautes</b></th><th><b>Herbonautes and not</b> <b>found in GBIF</b></th></tr></tbody><tbody><tr><th>Americas</th><td>700</td><td>248</td><td>7</td></tr><tr><th>Africa</th><td>268</td><td>189</td><td>17</td></tr><tr><th>Madagascar</th><td>79</td><td>79</td><td>10</td></tr><tr><th>Asia and Oceania</th><td>621</td><td>492</td><td>125</td></tr></tbody></table>
Coping with branch excision when measuring leaf net photosynthetic rates in a lowland tropical forest
Measuring leaf gas exchange from canopy leaves is fundamental for our understanding of photosynthesis and for a realistic representation of carbon uptake in vegetation models. Since canopy leaves are often difficult to reach, especially in tropical forests with emergent trees up to 60 meters at remote places, canopy access techniques such as canopy cranes or towers have facilitated photosynthetic measurements. These structures are expensive and therefore not very common. As an alternative, branches are often cut to enable leaf gas exchange measurements. The effect of branch excision on leaf gas exchange rates should be minimised and quantified to evaluate possible bias. We compared light-saturated leaf net photosynthetic rates measured on excised and intact branches. We selected branches positioned at three canopy positions, estimated relative to the top of the canopy: upper sunlit foliage, middle canopy foliage, and lower canopy foliage. We studied the variation of the effects of branch excision and transport amongst branches at these different heights in the canopy. After excision and transport, light-saturated leaf net photosynthetic rates were close to zero for most leaves due to stomatal closure. However, when the branch had acclimated to its new environmental conditions – which took on average 20 minutes –light-saturated leaf net photosynthetic rates did not significantly differ between the excised and intact branches. We therefore conclude that branch excision does not affect the measurement of light-saturated leaf net photosynthesis, provided that the branch is recut under water and is allowed sufficient time to acclimate to its new environmental conditions.
Data from: Tropical arboreal ants form dominance hierarchies over nesting resources
Interspecific dominance hierarchies have been widely reported across animal systems. High-ranking species are expected to monopolize more resources than low-ranking species via resource monopolization. In some ant species, dominance hierarchies have been used to explain species coexistence and community structure. However, it remains unclear whether or in what contexts dominance hierarchies occur in tropical ant communities. This study seeks to examine whether arboreal twig-nesting ants competing for nesting resources in a Mexican coffee agricultural ecosystem are arranged in a linear dominance hierarchy. We described the dominance relationships among 10 species of ants and measured the uncertainty and steepness of the inferred dominance hierarchy. We also assessed the orderliness of the hierarchy by considering species interactions at the network level. Based on the randomized Elo-rating method, we found that the twig-nesting ant species Myrmelachista mexicana ranked highest in the ranking, while Pseudomyrmex ejectus was ranked as the lowest in the hierarchy. Our results show that the hierarchy was intermediate in its steepness, suggesting that the probability of higher ranked species winning contests against lower ranked species was fairly high. Motif analysis and significant excess of triads further revealed that the species networks were largely transitive. This study highlights that some tropical arboreal ant communities organize into dominance hierarchies.
First explorations: ontogeny of central-place-foraging directions in two tropical seabirds
A widespread hypothesis for the ontogeny of behaviour and decision-making is the early-exploration-later-canalization hypothesis. It postulates that juveniles are more exploratory and adults more consistent in their behavior. In addition, it is often assumed that naïve juveniles could overcome the costs of individual experience building by copying more the decisions of others than adults (early-conformism-later-self-defining hypothesis). Here we compare the central-place-foraging movements of adults and post-fledging juveniles in their first flights around the colony before dispersal and migration, in two sympatric species of tropical seabirds: red-footed boobies and great frigatebirds. Using GPS records of individual movements, we analyzed the foraging directions of seabirds from the colony across successive trips. Juveniles of both species showed significant within-individual consistency in foraging direction but at lower levels than adults. Juveniles leaving the colony within the same time-window showed significant but low between-individual resemblance in foraging direction, at levels similar to adults. In both species, homing efficiency was lower in juveniles than in adults. Juvenile foraging directions were initially influenced by wind conditions, particularly in low-wing-loading frigatebirds. Wind conditions progressively lost influence on juvenile foraging directions during their first weeks of flights. In contrast within-individual consistency, between-individual resemblance and homing efficiency did not show signs of progression in juveniles. Our results support the early-exploration-later-canalization hypothesis but not the early-conformism-later-self-defining hypothesis. Relaxed constraints on self-feeding efficiency could favour high variability in post-fledging tropical seabirds. Our simple approach could be applied to further test these hypotheses by comparing strategies across a wide range of central-place foragers.
Data from: Lianas abundance is positively related with the avian acoustic community in tropical dry forests
Dry forests are important sources of biodiversity where lianas are highly abundant given their ability to grow during times of drought and as a result of secondary growth processes. Lianas provide food and shelter for fauna such as birds, but there are no studies assessing the influence of liana abundance on birds in dry forests. Here we evaluate the influence of liana abundance on the avian acoustic community in the dry forests of Costa Rica at Santa Rosa National Park. We selected forest sites with different levels of liana abundance and set up automated sound recorders for data collection, analysis and estimation of the avian acoustic community. When the number of lianas increases, the avian acoustic community becomes more complex. Lianas could provide important direct and indirect resources for birds such as structure for shelter, protection, nesting and roosting, and food. The positive relationship that lianas have with birds is particularly important in dry forests where lianas are becoming highly abundant due to the level of forest disturbance and climate change, especially for some bird species that are restricted to this ecosystem. By validating the number of bird species detected in the recordings with the acoustic complexity index, we found that a higher acoustic complexity means higher species richness.
Thinner bark increases sensitivity of wetter Amazonian tropical forests to fire
<p>Understory fires represent an accelerating threat to Amazonian tropical forests and can, during drought, affect larger areas than deforestation itself. These fires kill trees at rates varying from < 10 to c. 90% depending on fire intensity, forest disturbance history and tree functional traits. Here, we examine variation in bark thickness across the Amazon. Bark can protect trees from fires, but it is often assumed to be consistently thin across tropical forests. Here, we show that investment in bark varies, with thicker bark in dry forests and thinner in wetter forests. We also show that thinner bark translated into higher fire‐driven tree mortality in wetter forests, with between 0.67 and 5.86 gigatonnes CO<sub>2</sub> lost in Amazon understory fires between 2001 and 2010. Trait‐enabled global vegetation models that explicitly include variation in bark thickness are likely to improve the predictions of fire effects on carbon cycling in tropical forests.</p>
A standardized assessment of forest mammal communities reveals consistent functional composition and vulnerability across the tropics
<p class="MsoPlainText">Understanding global diversity patterns has benefitted from a focus on functional traits and how they relate to variation in environmental conditions among assemblages. Distant communities in similar environments often share characteristics, and for tropical forest mammals, this functional trait convergence has been demonstrated at coarse scales (110-200 km resolution), but less is known about how these patterns manifest at fine scales, where local processes (e.g., habitat features and anthropogenic activities) and biotic interactions occur. Here, we used standardized camera trapping data and a novel analytical method that accounts for imperfect detection to assess how the functional composition of terrestrial mammal communities for two traits – trophic guild and body mass – varies across 16 protected areas in tropical forests and three continents, in relation to the extent of protected habitat and anthropogenic pressures. We found that despite their taxonomic differences, communities generally have a consistent trophic guild composition, and respond similarly to these factors. Insectivores were found to be sensitive to the size of protected habitat and surrounding human population density. Body mass distribution varied little among communities both in terms of central tendency and spread, and interestingly, community average body mass declined with proximity to human settlements. Results indicate predicted trait convergence among assemblages at the coarse scale reflects consistent functional composition among communities at the local scale, suggesting that broadly similar habitats and selective pressures shaped communities with similar trophic strategies and responses to drivers of change. These similarities provide a foundation for assessing assemblages under anthropogenic threats and sharing conservation measures.Understanding global diversity patterns has benefitted from a focus on functional traits and how they relate to variation in environmental conditions among assemblages. Distant communities in similar environments often share characteristics, and for tropical forest mammals, this functional trait convergence has been demonstrated at coarse scales (110-200 km resolution), but less is known about how these patterns manifest at fine scales, where local processes (e.g., habitat features and anthropogenic activities) and biotic interactions occur. Here, we used standardized camera trapping data and a novel analytical method that accounts for imperfect detection to assess how the functional composition of terrestrial mammal communities for two traits – trophic guild and body mass – varies across 16 protected areas in tropical forests and three continents, in relation to the extent of protected habitat and anthropogenic pressures. We found that despite their taxonomic differences, communities generally have a consistent trophic guild composition, and respond similarly to these factors. Insectivores were found to be sensitive to the size of protected habitat and surrounding human population density. Body mass distribution varied little among communities both in terms of central tendency and spread, and interestingly, community average body mass declined with proximity to human settlements. Results indicate predicted trait convergence among assemblages at the coarse scale reflects consistent functional composition among communities at the local scale, suggesting that broadly similar habitats and selective pressures shaped communities with similar trophic strategies and responses to drivers of change. These similarities provide a foundation for assessing assemblages under anthropogenic threats and sharing conservation measures.</p>
Two decades of annual landscape-scale tree growth and dynamics in old-growth tropical rainforest in the CARBONO Project, La Selva Biological Station, 1997-2018
<p>Here we present the complete data series from a 21-yr study of the annual growth and dynamics of trees, palms and lianas in the old-growth tropical rainforest at the La Selva Biological Station in Costa Rica. These observations were part of the CARBONO Project, a multidisciplinary team study of forest carbon cycling. The project was designed to assess forest processes at the landscape scale by sampling with replication across the within-landscape edaphic heterogeneity typical of tropical forests. Through more than two decades, forest growth and dynamics were assessed annually. The annual time-step used in the CARBONO Project effectively captured forest responses to major disturbances and to interannual and climatic variation. Annual measurements also enhanced the accuracy and long-term consistency of the data. To our knowledge, the resulting records are unique for tropical forests, where the dominant approach to studying the dynamics of a given forest has been to use a single plot and multi-year inter-census intervals. To date these CARBONO Project data have revealed: multi-decadal forest stability in spite of the short-term changes in forest structure resulting from major natural disturbances (e.g., the 1997-1998 Strong El Niño, and the extreme windstorm of May 2018); the dynamics and importance of large trees; and the responses of a major component of ecosystem productivity, aboveground wood production, to interannual and long-term climatic and atmospheric change. These data have also contributed to many remote-sensing studies.</p> <p>The data set consists of annual observations through the period 1997–2018 of the floristics, survival, recruitment, and growth of all woody stems (diameter <u>></u> 10 cm) in a landscape-scale plot network. At completion of the study, the data spanned 6705 individuals and 21 years. The data set is complete and has been through extensive internal checks for quality assurance. Detailed data documentation and an emphasis on measurement repeatability were prioritized through the study. The metadata include an extensive README file describing the data files and the methods, a document detailing the data management and qa/qc, and the scanned original field data-sheets for the 22 annual censuses.</p> <p>We gratefully acknowledge the careful long-term field work and data entry and checking by paraforesters Leonel Campos Otoya and William Miranda Conejo. Logistical support and the long-term protection of the La Selva reserve were provided by the Organization for Tropical Studies. The Ministerio de Ambiente y Energía of Costa Rica granted permits to carry out this study through the years of the study (most recently: Resolución No. 037-2018-ACCVC-PI).</p>
Landslide age, elevation and residual vegetation determine tropical montane forest canopy recovery and biomass accumulation after landslide disturbances in the Peruvian Andes
<p>Landslides are common natural disturbances in tropical montane forests. While the geomorphic drivers of landslides in the Andes have been studied, factors controlling post-landslide forest recovery across the steep climatic and topographic gradients characteristic of tropical mountains are poorly understood.</p> <p>Here we use a LiDAR-derived canopy height map coupled with a 25-year landslide time series map to examine how landslide, topographic, and biophysical factors, along with residual vegetation, affect canopy height and heterogeneity in regenerating landslides. We also calculate aboveground biomass accumulation rates and estimate the time for landslides to recover to mature forest biomass levels.</p> <p>We find that age and elevation are the biggest determinants of forest recovery, and that the jump-start in regeneration that residual vegetation provides lasts for at least 18 years. Our estimates of time to biomass recovery (31.6-37.1 years) are surprisingly rapid, and as a result we recommend that future research pair LiDAR with hyperspectral imagery to estimate forest aboveground biomass in frequently disturbed landscapes.</p> <p>Synthesis: Using a high-resolution LiDAR dataset and a time-series inventory of 608 landslides distributed across a wide elevational gradient in Andean montane forest, we show that age and elevation are the most influential predictors of forest canopy height and canopy variability. Other features of landslides, in particular the presence of residual vegetation, shape post-landslide regeneration trajectories. LiDAR allows for a detailed analysis of forest structural recovery across large landscapes and numbers of disturbances, and provides a reasonable upper bound on aboveground biomass accumulation rates. However, because this method does not capture the effect of compositional change through succession on aboveground biomass, wherein high-wood density species gradually replace light-wooded pioneer species, it overestimates aboveground biomass. Given previously estimated stem turnover rates along this elevational gradient, we posit that aboveground biomass recovery takes at least three times as long as our recovery time estimates based on LiDAR-derived structure alone.</p>
Data from: Trait‐based signatures of cloud base height in a tropical cloud forest
<p>Clouds have profound consequences for ecosystem structure and function. Yet, the direct monitoring of clouds and their effects on biota is challenging especially in remote and topographically complex tropical cloud forests. We argue that known relationships between climate and the taxonomic and functional composition of plant communities may provide a fingerprint of cloud base height, thus providing a rapid and cost-effective assessment in remote tropical cloud forests. To detect cloud base height, we compared species turnover and functional trait values among herbaceous and woody plant communities in an ecosystem dominated by cloud formation. We measured soil and air temperature, soil nutrient concentrations, and extracellular enzyme activity. We hypothesized that woody and herbaceous plants would provide signatures of cloud base height, as evidenced by abrupt shifts in both taxonomic composition and plant function. We demonstrated abrupt changes in taxonomic composition and the community-weighted mean of a key functional trait, specific leaf area, across elevation for both woody and herbaceous species, consistent with our predictions. However, abrupt taxonomic and functional changes occurred 100 m higher in elevation for herbaceous plants compared to woody ones. Soil temperature abruptly decreased where herbaceous taxonomic and functional turnover was high. Other environmental variables including soil biogeochemistry did not explain the abrupt change observed for woody plant communities. We provide evidence that a trait-based approach can be used to estimate cloud base height. We outline how rises in cloud base height and differential environmental requirements between growth forms can be distinguished using this approach.</p>
Genomic signatures of rapid adaptive divergence in a tropical montane species
<p>This dataset contains data from a study described in the paper: Ericson, P.G.P., Irestedt, M., She, H., and Qu, Y. (2021) "Genomic signatures of rapid adaptive divergence in a tropical montane species". <em>Biology Letters</em> (in print).</p> <p>The study investigates allopatric divergence and selection in Archbold's Bowerbird (<i>Amblyornis papuensis</i>), an iconic bird living in a tropical mountain region in New Guinea, using a novel chromosome-level genome and population genomic comparisons.</p> <p>Our results show that the two populations inhabiting the eastern and western Central Range became isolated ca 11,800 years ago, probably because the suitable habitats for this cold-tolerating bird decreased when the climate got warmer. Our genomic scans detect that genes in highly divergent genomic regions are over-represented in developmental processes, which is likely associated with the observed differences in body size between the populations. Overall, our results suggest that environmental differences between eastern and western Central Range likely drive adaptive divergence between them.</p>
Autogenic regulation and resilience in tropical dry forest
<p>1. Engineering resilience, a forest's ability to maintain its properties in the event of disturbance, comprises two components: resistance and recovery. In human-dominated landscapes, forest resilience depends mostly on recovery. Forest recovery largely depends on autogenic regulation, which entails a negative feedback loop between rates of change of forest state variables and state variables themselves. Hence community dynamics changes in response to deviations from forest equilibrium state. Based on the premise that autogenic regulation is a key aspect of the recovery process, here we tested the hypothesis that combined old-growth forest (OGF) and secondary forest (SF) dynamics should show autogenic regulation in state variables, and thus convergence towards OGF-based reference points, indicating forest resilience.</p> <p>2. We integrated dynamic data for OGF (11-year monitoring) and SF (16-year monitoring) to analyse three key state variables (basal area, tree density, species richness), their annual rates of change, and their underlying demographic processes (recruitment, growth, mortality). We examined autogenic regulation through generalized linear mixed-effects models (GLMMs) to quantify functional relationships between rates of change of state variables (and underlying demographic processes), and their respective state variables.</p> <p>3. State variables in OGF decreased moderately over time, against our prediction of OGF constancy. In turn, the three state variables analysed showed negative relationships with their respective rates of change, which allows the return of SF to OGF values after disturbance. In all cases, recruitment decreased with increasing values in state variables, while mortality increased.</p> <p>4. The observed negative relationships between state variables, their rates of change and their underlying demographic processes support our hypothesis of integrated OGF and SF dynamics showing autogenic regulation for state variables. Competition seems to be a major driver of autogenic regulation given its dependence on a resource availability that declines as forest structure develops.</p> <p>5. Synthesis. Based on a straightforward and comprehensive approach to quantify the extent to which tropical forest dynamics is self-regulated, this study highlights the role of autogenic regulation in tropical dry forest as a basic component of its resilience. This approach is potentially valuable for a generalised assessment of engineering resilience of forests worldwide.</p>
Data from: Tropical understory herbaceous community responds more strongly to hurricane disturbance than to experimental warming
<p>The effects of climate change on tropical forests may have global consequences due to the forests' high biodiversity and major role in the global carbon cycle. In this study, we document the effects of experimental warming on the abundance and composition of a tropical forest floor herbaceous plant community in the Luquillo Experimental Forest, Puerto Rico. This study was conducted within Tropical Responses to Altered Climate Experiment (TRACE) plots, which use infrared heaters under free-air, open-field conditions, to warm understory vegetation and soils +4 °C above nearby control plots. Hurricanes Irma and María damaged the heating infrastructure in the second year of warming, therefore, the study included one pre-treatment year, one year of warming, and one year of hurricane response with no warming. We measured percent leaf cover of individual herbaceous species, fern population dynamics, and species richness and diversity within three warmed and three control plots.</p> <p>Results showed that one year of experimental warming did not significantly affect the cover of individual herbaceous species, fern population dynamics, species richness, or species diversity. In contrast, herbaceous cover increased from 20% to 70%, bare ground decreased from 70% to 6%, and species composition shifted pre- to post-hurricane. The negligible effects of warming may have been due to the short duration of the warming treatment or an understory that is somewhat resistant to higher temperatures. Our results suggest that climate extremes that are predicted to increase with climate change, such as hurricanes and droughts, may cause more abrupt changes in tropical forest understories than longer-term sustained warming.</p>
The effect of tropical forest modification on primate population density and diversity
<b>Description: </b><p>This data represents orang-utan nest survey data, collected to investigate the effects of habitat disturbance on orang-utan populations. Our surveys were conducted in and around the SAFE project site, including areas of Ulu Segama forest reserves and surrounding oil palm estates, covering a total study area of ca. 13,000ha. We conducted nest surveys between April and August 2017, using the standing crop method. Transects were surveyed once by teams of two to four people walking at a steady pace of roughly 0.5km/hr. The data primarily contains perpendicular distances from directly under each nest we encountered to the transect line. We assigned a decay category to each nest, ranging from 1 (new nest) to 5 (heavily degraded). Additionally we recoded the location of each nest, the height of the nest and DBH of the host tree. </p><p><b>Project: </b>This dataset was collected as part of the following SAFE research project: <a href="https://www.safeproject.net/projects/project_view/30"><b>The effect of tropical forest modification on primate population density and diversity.</b></a></p><p><b>Funding: </b>These data were collected as part of research funded by: </p><ul><li>NERC - Human Modified Tropical Forest (HMTF) (Standard grant, NE/K016407/1, <a href=" http://lombok.nerc-hmtf.info/"> http://lombok.nerc-hmtf.info/</a>)</li><li>Primate Society of Great Britain (Conservation grant, NA, <a href="http://www.psgb.org/conservation_grants.php">http://www.psgb.org/conservation_grants.php</a>)</li></ul><p>This dataset is released under the CC-BY 4.0 licence, requiring that you cite the dataset in any outputs, but has the additional condition that you acknowledge the contribution of these funders in any outputs.</p><p></p><p><b>Permits: </b>These data were collected under permit from the following authorities:</p><ul><li>Sabah Biodiversity Centre (Research licence JKM/MBS.1000-2/2 JLD.4(104))</li></ul><p></p><p><b>XML metadata: </b>GEMINI compliant metadata for this dataset is available <a href="https://www.safeproject.net/datasets/xml_metadata?id=5109892">here</a></p><p><b>Files: </b>This consists of 1 file: Orangutan_Transect_Data.xlsx</p><p><b>Orangutan_Transect_Data.xlsx</b></p><p>This file contains dataset metadata and 1 data tables:</p><ol><li><p><b>Orang-utan nest survey data</b> (described in worksheet Distance_data)</p><p>Description: Data from orang-utan nest surveys, using the standing crop method to collect perpendicular distances of orang-utan nests from line transects.</p><p>Number of fields: 13</p><p>Number of data rows: 677</p><p>Fields: </p><ul><li><b>Region</b>: Area in which the survey took place (Field type: id)</li><li><b>Habitat_Type</b>: Habitat type of the transect location (Field type: id)</li><li><b>Transect</b>: Transect ID (Field type: location)</li><li><b>TranLenght</b>: Transect length (Field type: numeric)</li><li><b>Side</b>: Side of the transect nest was located (L = left, R= Right and OT= On transect) (Field type: categorical)</li><li><b>Dist</b>: Perpendicular distance from direct under nest to the transect line (Field type: numeric)</li><li><b>Slope</b>: Angle of slope from transect line (measured to compensate for measuring perpendicular distance of steel slopes) (Field type: numeric)</li><li><b>Class</b>: Age class of east nest (From 1 = new nest to 5 = very old nest) (Field type: numeric)</li><li><b>Nest_Height</b>: Height of each nest in host tree (Field type: numeric trait)</li><li><b>DBH</b>: DBH of host tree (Field type: numeric)</li><li><b>Lat_Y</b>: Nest location latitude (Field type: latitude)</li><li><b>Long_X</b>: Nest location longitude (Field type: longitude)</li><li><b>Elevation</b>: Height above sea leave at each nest location (Field type: numeric)</li></ul></li></ol><p><b>Date range: </b>2017-04-01 to 2017-08-28</p><p><b>Latitudinal extent: </b>4.5607 to 4.7828</p><p><b>Longitudinal extent: </b>117.4636 to 117.7008</p><p><b>Taxonomic coverage: </b><br> All taxon names are validated against the GBIF backbone taxonomy. If a dataset uses a synonym, the accepted usage is shown followed by the dataset usage in brackets. Taxa that cannot be validated, including new species and other unknown taxa, morphospecies, functional groups and taxonomic levels not used in the GBIF backbone are shown in square brackets.</p><div> -  Animalia <br> -  -  Chordata <br> -  -  -  Mammalia <br> -  -  -  -  Primates <br> -  -  -  -  -  Hominidae <br> -  -  -  -  -  -  <i>Pongo</i> <br> -  -  -  -  -  -  -  <i>Pongo pygmaeus</i> <br></div><p></p>
Data from: Narrow thermal tolerance and low dispersal drive higher speciation in tropical mountains
Species richness is greatest in the tropics and much of this diversity is concentrated in mountains. Janzen (1967) proposed that reduced seasonal temperature variation selects for narrower thermal tolerances and limited dispersal along tropical elevation gradients. These locally adapted traits should, in turn, promote reproductive isolation and higher speciation rates in tropical mountains compared to temperate ones. Here we show that tropical and temperate montane stream insects have diverged in thermal tolerance and dispersal capacity, two key traits that are drivers of isolation in montane populations. Tropical species in each of three insect clades have markedly narrower thermal tolerances and lower dispersal than temperate species, resulting in significantly greater population divergence, higher cryptic species diversity, higher tropical speciation rates, and greater accumulation of species over time. Our study also indicates that tropical montane species, with narrower thermal tolerance and reduced dispersal ability, will be especially vulnerable to rapid climate change.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.