Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
60
datasets available to search
ShareScore release 0.9.0
Dataset results
60 results for “12S”
12S metabarcoding reference data from the Research Institute for Nature and Forest (INBO)
<p>This dataset contains metabarcoding reference data with 12S sequences from fish and other vertebrates for Teleo and Riaz primers suited for use with the <a href="https://git.metabarcoding.org/obitools/obitools/wikis/home/">OBITools</a> package.</p> <p><strong>Files</strong><br>- <strong>all_seqs_INBO_riaz_amplified.fasta</strong>: reference data for Riaz marker<br>- <strong>all_seqs_INBO_Valentini_teleo_amplified.fasta</strong>: reference data for Teleo marker<br>- <strong>species_INBO_riaz.csv</strong>: species for which reference data is included in Riaz dataset<br>- <strong>species_INBO_teleo.csv</strong>: species for which reference data is included in Teleo dataset</p>
Concatenated alignment of 12S and 16S sequences of the genus Pristimantis.
<p>A new species of Pristimantis (Amphibia, Anura, Strabomantidae) from a montane forest of the Pui Pui Protected Forest in central Peru</p>
Fig. 3. Neighbour-joining tree contructed from partial 12S in A combined morphological and molecular approach in identifying barnacle cyprids from the Matang Mangrove Forest Reserve in Malaysia: essentials for larval ecology studies
Fig. 3. Neighbour-joining tree contructed from partial 12S-rRNA gene fragment sequences of cyprids and adults of barnacle. The sequences were clustered into eight clades, and species name were labelled at the clades containing sequence(s) of identified adult of barnacle. Clades with no sequence of identified barnacle adult clustered within were designated as OTU (Operational Taxonomic Unit). Number of sequences in each clade were also shown. Scale bar denotes 0.02 base substituition per site.
rCRUX Generated MiFish Universal 12S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in January 2024.</p> <p>Primer Name: MiFish Universal<br>Gene: 12S<br>Length of Target: 163–185<br>get_seeds_local() minimum length: 170<br>get_seeds_local() maximum length: 400<br>blast_seeds() minimum length: 140<br>blast_seeds() maximum length: 400<br>max_to_blast: 1000<br>Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br>Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br>Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p> <p>This project was funded by the NOAA 'Omics Program.</p>
Fig. 4 in MITOCHONDRIAL 16S AND 12S rRNA SEQUENCE ANALYSIS IN FOUR SALMONID SPECIES FROM ROMANIA
Fig. 4. Majority with bootstrap support consensus trees for combined data (16S rRNA and 12S rRNA). (a) Combined data Neighbor Joining tree, distance model Kimura 2 Parameters, transition/transversion ratio 2.3; (b) combined data Maximum Parsimony tree; (c) combined data Maxi-
Fig. 3. Majority with bootstrap support consensus trees for 12S in MITOCHONDRIAL 16S AND 12S rRNA SEQUENCE ANALYSIS IN FOUR SALMONID SPECIES FROM ROMANIA
Fig. 3. Majority with bootstrap support consensus trees for 12S rRNA. (a) 12S rRNA Maximum Parsimony tree; (b) 12S rRNA Neighbor Joining tree, distance model Kimura 2 Parameters, transi-
Fig. 2. Majority with bootstrap support consensus trees for 16S in MITOCHONDRIAL 16S AND 12S rRNA SEQUENCE ANALYSIS IN FOUR SALMONID SPECIES FROM ROMANIA
Fig. 2. Majority with bootstrap support consensus trees for 16S rRNA. (a) 16S rRNA Neighbor Joining tree, distance model Kimura 2 Parameters, transition/transversion ratio 2.3; (b) 16S rRNA Maximum Parsimony tree; (c) 16S rRNA Maximum Likelihood tree
Fig. 3. Haplotype networks for A. oahuensis. Panels correspond with the 12S in Tuerkayana latens Ng and Hsi-Te Shih 2023, n. sp.
Fig. 3. Haplotype networks for A. oahuensis. Panels correspond with the 12S rDNA gene (Panel A), 16S rDNA gene (Panel B), COI (Panel C), and H3A (Panel D). Colors and locality IDs correspond with those used in all other Figures. Black circles represent unsampled (i.e., missing) haplotypes, with the size of circles proportional to the frequency at which each haplotype was recovered.
Fig. 2. Maximum likelihood tree for Crematogaster rothneyi and C. yaharai inferred from 12S in Fig. 7 in Effect of Kleptoparasitic Ants on the Foraging Behavior of a Social Spider ( Karsch, 1891).
Fig. 2. Maximum likelihood tree for Crematogaster rothneyi and C. yaharai inferred from 12S rRNA sequences (12S, 387 bp). Numbers above nodes indicate the bootstrap values. Please note, only one sequence from each population was available.
Figure 6. Four most parsimonious phylogenetic trees for 12S in New insight into the systematic position of the endemic Madagascan genus Amberiana (Hemiptera: Heteroptera: Dinidoridae) using 12S rDNA sequences
Figure 6. Four most parsimonious phylogenetic trees for 12S rDNA sequences of 28 species used in this study generated using the maximum parsimony method. Bootstrap support is indicated at nodes; the frame shows the clade consisting of Amberiana montana and Sehirus luctuosus.
Figure 5. Phylogenetic tree for 12S in New insight into the systematic position of the endemic Madagascan genus Amberiana (Hemiptera: Heteroptera: Dinidoridae) using 12S rDNA sequences
Figure 5. Phylogenetic tree for 12S rDNA sequences of 28 species used in this study generated by using the maximum likelihood method. Bootstrap support is indicated at nodes; the frame shows the clade consisting of Amberiana montana and Sehirus luctuosus.
Figure 9 in New insight into the systematic position of the endemic Madagascan genus Amberiana (Hemiptera: Heteroptera: Dinidoridae) using 12S rDNA sequences
Figure 9. Phylogenetic tree obtained from the Bayesian inference analysis of the 12S rDNA sequences of 28 species used in this study. The Bayesian posterior probabilities are indicated at each node; the frame shows the clade consisting of Amberiana montana and Sehirus luctuosus.
Figures 1−3. 1 in New insight into the systematic position of the endemic Madagascan genus Amberiana (Hemiptera: Heteroptera: Dinidoridae) using 12S rDNA sequences
Figures 1−3. 1: Amberiana montana. 2: A. major (from Lis, 1990). 3: Location of known records for the 2 Amberiana species.
Figure 4. Phylogenetic tree for 12S in New insight into the systematic position of the endemic Madagascan genus Amberiana (Hemiptera: Heteroptera: Dinidoridae) using 12S rDNA sequences
Figure 4. Phylogenetic tree for 12S rDNA sequences of 28 species used in this study generated by using the minimum evolution method. Bootstrap support is indicated at nodes; the frame shows the clade consisting of Amberiana montana and Sehirus luctuosus.
Figure 7 in New insight into the systematic position of the endemic Madagascan genus Amberiana (Hemiptera: Heteroptera: Dinidoridae) using 12S rDNA sequences
Figure 7. Strict consensus tree of 4 most parsimonious trees for 12S rDNA sequences of 28 species used in this study generated by using the maximum parsimony method. The frame shows the clade consisting of Amberiana montana and Sehirus luctuosus.
Fig. 3. Bayesian phylogenetic tree using the 12S in Characterization of aortic and brachiocephalic filariasis by Filarioidea sp (Nematoda:Spirurida:Filarioidea) in Mexican ramphastids
Fig. 3. Bayesian phylogenetic tree using the 12S mitochondrial sequences for different species of filariae. The number of the nodes indicate the values of support or posterior probability.
Figure 2. Proposed 12S in Phylogenetic relationships of thorny catfishes (Siluriformes: Doradidae) inferred from molecular and morphological data
Figure 2. Proposed 12S rRNA secondary structure model for Doradidae. Single bases enclosed in squares indicate positions thought to be involved in the decoding mechanism.
Figure 1 in Evolutionary systematics of the Indian mouse Mus famulus Bonhote, 1898: molecular (DNA/DNA hybridization and 12S rRNA sequences) and morphological evidence
Figure 1. Phylogenetic trees derived from the DNA/DNA hybridization analysis. A and B: Consensus trees resulting from the bootstrap analysis of delta-Tm (A) and delta-mode (B) 12*12 matrices. BP values are indicated when different from 100%. The lengths of the branches correspond to one tree arbitrarily selected among those of the consensus. C and D: Average consensus trees resulting from the weighted jacknife procedure for delta-Tm (C) and delta-mode (D) 13*13 matrices. The thin lines represent nodes that were not present in maximum and minimum consensus trees or that are not supported for all combinations of single deletion analysis. uUnlabelled taxa. The names in bold indicate the differences that can be observed between the two distance estimators (Tm, Mode).
Figure 4 in Evolutionary systematics of the Indian mouse Mus famulus Bonhote, 1898: molecular (DNA/DNA hybridization and 12S rRNA sequences) and morphological evidence
Figure 4. Fifty per cent majority rule consensus of 52 trees derived from the morphological analysis. Each mostparsimonious tree is 54 steps long, and has a Consistency Index of 0.52, a Retention Index of 0.72, and a Rescaled Consistency Index of 0.37. Values given below the branches represent the percentage of trees containing the specified clades.
Figure 3. Synthetic tree derived from the 12S in Evolutionary systematics of the Indian mouse Mus famulus Bonhote, 1898: molecular (DNA/DNA hybridization and 12S rRNA sequences) and morphological evidence
Figure 3. Synthetic tree derived from the 12S rRNA datasets with the inclusion of all substitutions (TV + TI). The thin lines indicate nodes that are not robustly supported by all kinds of analysis. The robustness of the different nodes are indicated as follows: [BP(BPweighted analysis)/BSI (Parsimony)]/[BP(NJ)/Reliability Percentage (ML)].
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.